<?xml version="1.0" encoding="iso-8859-1" ?>
<rss version="2.0">
  <channel>
    <title>Nucleics Forum</title>
    <link>http://www.nucleics.com/forum/index.php</link>
    <description><![CDATA[]]></description>
    <language>EN</language>
    <pubDate>Tue, 06 Dec 2011 15:40:15 +1100</pubDate>
    <lastBuildDate>Tue, 06 Dec 2011 15:40:15 +1100</lastBuildDate>
    <category>Nucleics Forum</category>
    <generator>Phorum 5.1.22</generator>
    <ttl>600</ttl>
    <item>
      <title>[General Questions] Re: DNA Analysis software</title>
      <link>http://www.nucleics.com/forum/read/11/789/4399.html#msg-4399</link>
      <author>vatuan13</author>
      <description><![CDATA[I have the same problem at Human mtDNA, so i must use using some mini primer sets to solve this problem.]]></description>
      <category>General Questions</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/11/789/4399.html#msg-4399</guid>
      <pubDate>Tue, 06 Dec 2011 15:40:15 +1100</pubDate>
    </item>
    <item>
      <title>[General Questions] Re: ABI 3130 &amp; CEQ 8800 comparison</title>
      <link>http://www.nucleics.com/forum/read/11/783/4398.html#msg-4398</link>
      <author>vatuan13</author>
      <description><![CDATA[I only choice ABI3130, best for analysis PCR Fragments!]]></description>
      <category>General Questions</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/11/783/4398.html#msg-4398</guid>
      <pubDate>Tue, 06 Dec 2011 15:35:09 +1100</pubDate>
    </item>
    <item>
      <title>[PCR Forum] nematode gut amplification</title>
      <link>http://www.nucleics.com/forum/read/12/4393/4393.html#msg-4393</link>
      <author>storytime</author>
      <description><![CDATA[Hello,

I have been working on amplifying bacteria from the guts of c.elegans.

My protocol is as follows:

- extract gut from nematode (yes the gut is less than a 1 mm wide and about 3-5 mm long)
- freeze for 10 mins (at -80) to lyse the cells
- run a 5% prot k treatment
- add reagents for PCR as follows:

2.5-2.9 uL of MgCl2
3 uL of Hot Start Buffer
3 uL of each primer (forward and reverse, im using 1492R and 27F)
1 uL of dntps at 6 uM conecntration
14.44-14.04 uL of H2O (altered based on mgcl2 amount)
2.5 uL (approx) of DNA sample

30 uL total volume

using an annealing temp of 54 C and running a standard protocol with 35 cycles. also added an extra 5min at 95 C, at the start before the loop. [even added extra 30 seconds (1.5 min total) to extension cycle but still didnt work]

My problem is that I get NO amplification. The positive control shows up (using extracted genomic DNA from streak) but I see no bands for my samples. Occasionally I see one or two (out of 5) but it is extremely inconsistent.

I have tried running a MgCl2 gradient (2.5, 2.7, 2.9, 3.1 etc...) to no avail.

I've heard that my sample could be amplifying but that its still two low to see a band. I've quantified the product via Qubit and they are substantially (10 fold) more concentrated than my -control (all reagents but no template). For some reason however doing a nested PCR doesn't seem to produce results.

I have tried to proceed with the spotty results that I get (TOPO cloning vector) but unfortunately there seemed to be no insert in the vectors after amplifying 20-30 different colonies and attempting the whole cloning a second time.

The price of the cloning is far to expensive for me to keep attempting and I was hoping that at some point I would get my guts to amplify at least 80% of the time.

Anybody have any suggestions as to what I might to do improve the amplification and/or verify that I actually have product even if the bands are not showing up.

I have been working on this for almost a year and it is very discouraging. Please help :(]]></description>
      <category>PCR Forum</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/12/4393/4393.html#msg-4393</guid>
      <pubDate>Tue, 01 Nov 2011 16:55:36 +1100</pubDate>
    </item>
    <item>
      <title>[PCR Forum] PAPD PCR</title>
      <link>http://www.nucleics.com/forum/read/12/4392/4392.html#msg-4392</link>
      <author>Hano</author>
      <description><![CDATA[I need to know about RAPD PCR, please guide me how can I get good practical information about this subject to start my project]]></description>
      <category>PCR Forum</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/12/4392/4392.html#msg-4392</guid>
      <pubDate>Sat, 08 Oct 2011 06:15:39 +1100</pubDate>
    </item>
    <item>
      <title>[PCR Forum] poly AAAAAAAA at both ends?</title>
      <link>http://www.nucleics.com/forum/read/12/4391/4391.html#msg-4391</link>
      <author>addishah</author>
      <description><![CDATA[So folks,

I repeatedly face a problem recently where sequences I get back from the sequencer appear to have long stretches of poly A at both ends, meaning that I can't get sequence with either M13 forward or M13 reverse sequencing primer. I don't think I want the sequence of these anyway, but my point is- what causes this kind of product to be produced and how can avoid it being produced in future?]]></description>
      <category>PCR Forum</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/12/4391/4391.html#msg-4391</guid>
      <pubDate>Mon, 04 Jul 2011 14:37:20 +1000</pubDate>
    </item>
    <item>
      <title>[dLUTE SEQ Forum] Can I use dLUTE with ABI 310?</title>
      <link>http://www.nucleics.com/forum/read/7/4390/4390.html#msg-4390</link>
      <author>hericorreia</author>
      <description><![CDATA[Can I use dLUTE with ABI 310?]]></description>
      <category>dLUTE SEQ Forum</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/7/4390/4390.html#msg-4390</guid>
      <pubDate>Thu, 09 Jun 2011 12:49:15 +1000</pubDate>
    </item>
    <item>
      <title>[PCR Forum] Re: PCR trascendental questions</title>
      <link>http://www.nucleics.com/forum/read/12/4385/4387.html#msg-4387</link>
      <author>nucleics</author>
      <description><![CDATA[Firstly, Taq is not unstable at room temperature. 

Secondly, I am not sure where you got this 1:100 template to primer ratio from but this is also wrong. I guess if you your assumptions are wrong then you should not be surprised when the results don't make much sense :)

Daniel]]></description>
      <category>PCR Forum</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/12/4385/4387.html#msg-4387</guid>
      <pubDate>Mon, 09 May 2011 18:07:15 +1000</pubDate>
    </item>
    <item>
      <title>[PCR Forum] PCR trascendental questions</title>
      <link>http://www.nucleics.com/forum/read/12/4385/4385.html#msg-4385</link>
      <author>dalpa8</author>
      <description><![CDATA[I'm relatively a newbie in PCR but I'm trying to find out some info and didn't get it. 
I have these 2 concerns: 

1) why is Taq polymerase so unstable at room temperature but stable at 95C? 


2) All the PCR protocols I found mostly have a ratio of template/primers around 1:100. This is the problem I see: every cycle we do, we are consuming primers at the same rate of PCR products are formed. Basic maths showed that by cycle 6-7 (around 128 PCR products) all of our primers should have been used and therefore the PCR reaction shouldn't go on. 
I feel that I'm missing something important because all that I found repeat the 1:100 template/primer ratio. 
I'll appreciate your help!
Thank you,
David]]></description>
      <category>PCR Forum</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/12/4385/4385.html#msg-4385</guid>
      <pubDate>Sat, 07 May 2011 03:11:20 +1000</pubDate>
    </item>
    <item>
      <title>[RNA Isolation Forum] RNA Isolation Help!</title>
      <link>http://www.nucleics.com/forum/read/14/4384/4384.html#msg-4384</link>
      <author>mfrank</author>
      <description><![CDATA[I am isolating RNA from cartilage, which is notoriously difficult due to the low cell count and stiffness of the tissue. The eventual application is q-PCR analysis. We use a hybrid TRIzol/RNeasy protocol that goes something like this:

homogenize with trizol,
three extractions with TRIzol/BCP
Isopropanol precipitation
Resuspend in 150uL RNAse free H20, mix with equal volume 80% EtOH
Apply to QIAgen RNeasy spin column and clean according to directions.
Elute in volume of 30 uL, running eluate through membrane twice to increase RNA yield

On a good day, average yield is 30-40 ng/uL, with a 260/280 of 1.8+, and 260/230 of 1.3 ish. 
On a great day, can get as much as 70ng/uL, with slightly better readings of 260280 and 260/230. 

But sometimes my results are all over the place! Yesterday, I did fifteen isolations, and two of them were very good in yield and ratios. In the rest, though, I had a yield of only 5-10ng/uL, an awful 260/280 ratios of 1.2-1.5, and 260/230 ratios of 0.3-0.8. 

I just don't get it. Why, on the same isolation, am I somehow losing my RNA in many of my samples? I had lovely pellets for all of them, saw them dissolve in the water before applying to the column, and somehow through the qiagen protocol I lost everything? Does anyone have any clue? We are not overloading the column since there is a capactiy of 200ug, and even at my best 70ng/ul, that is only 2 ug in a total of 30uL! 

Please help, it is so frustrating and I don't want to lose all of my samples!]]></description>
      <category>RNA Isolation Forum</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/14/4384/4384.html#msg-4384</guid>
      <pubDate>Fri, 29 Apr 2011 23:36:19 +1000</pubDate>
    </item>
    <item>
      <title>[PCR Forum] Re: PCR  Tell me the particular annealing temp for these primer</title>
      <link>http://www.nucleics.com/forum/read/12/102/4260.html#msg-4260</link>
      <author>elizabeth</author>
      <description><![CDATA[I have 32 isolates from soil . I have also extracted the DNA and doing the 16S rDNA pcr amplification. But for one group of isolates I am the primer I used has annealing temperature 58 as compare to another group of isolates which is 63 for the same primer.]]></description>
      <category>PCR Forum</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/12/102/4260.html#msg-4260</guid>
      <pubDate>Tue, 05 Apr 2011 20:08:50 +1000</pubDate>
    </item>
    <item>
      <title>[PCR Forum] Re: No amplification - Taqman</title>
      <link>http://www.nucleics.com/forum/read/12/4249/4250.html#msg-4250</link>
      <author>nucleics</author>
      <description><![CDATA[Do you have a positive control for the reverse transcription step? Do you have another PCR primer set that you can use on the cDNA (a house keeping gene) that you can use to check that cDNA is OK. Have you tried spiking in DNA to make sure there are no inhibitors present?]]></description>
      <category>PCR Forum</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/12/4249/4250.html#msg-4250</guid>
      <pubDate>Fri, 25 Mar 2011 07:47:33 +1100</pubDate>
    </item>
    <item>
      <title>[PCR Forum] No amplification - Taqman</title>
      <link>http://www.nucleics.com/forum/read/12/4249/4249.html#msg-4249</link>
      <author>C. Sipert</author>
      <description><![CDATA[I performed the RNA isolation from cell lisate in Trizol with a spin column kit. Prior to RNA isolation, the samples were stored at -80oC. Reading at Nanodrop is ok. RNA gels show both RNA bands. However, after performing the reverse transcription (Qiagen kit), we are not able to obtain any amplification of RPL13 gene throught qPCR using Taqman Mix (Applied Biosystems). The primers and probe are ok. We just can't figure out the possible existing problems.]]></description>
      <category>PCR Forum</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/12/4249/4249.html#msg-4249</guid>
      <pubDate>Fri, 25 Mar 2011 06:48:14 +1100</pubDate>
    </item>
    <item>
      <title>[PCR Forum] Re: PCR product storage</title>
      <link>http://www.nucleics.com/forum/read/12/409/4244.html#msg-4244</link>
      <author>Rizi</author>
      <description><![CDATA[hi
my issue is also related to PCR storage product, the problem is that I am doing my PCRs and finnlizing before purification and sequencing, and have to send the sample after PCR (without any purification) to the lab for purification as well sequencing (as v hav't both of these right now in our lab), thus please tell how long I could store my PCRs product and at what temperature??and at what way best to send the samples safely to outside country...



anxiously waiting for kind response]]></description>
      <category>PCR Forum</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/12/409/4244.html#msg-4244</guid>
      <pubDate>Sun, 20 Mar 2011 17:07:34 +1100</pubDate>
    </item>
    <item>
      <title>[General Questions] strange conflict</title>
      <link>http://www.nucleics.com/forum/read/11/4234/4234.html#msg-4234</link>
      <author>nicolas</author>
      <description><![CDATA[Hello,
I have an issue with some sequences I got from a miniprep and I would like to have your opinion on it.
I sent the same miniprep for sequencing with  6 different primers that cover a 3 Kbp long insert.
Among these primers 3 give a sequence that partially overlap.
2 are reverse primed, and one is forward primed.
The funny thing is that for a particular nucleotide position, in one orientation I get a clear identity, but in the other one I get a clear but different identity.
Forward position identity (in green) is an A, while reverse (in red) is a T.
I think this cannot be a mixture of plasmids as in that case, the picks would both appear on the sequencing trace as overlapping and of similar intensities.
Among the 5 minipreps, this position reproducibly comes up with this &quot;defect&quot;.
Anyone ever experienced that?
Every feedback is welcome.
Thanks.]]></description>
      <category>General Questions</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/11/4234/4234.html#msg-4234</guid>
      <pubDate>Thu, 10 Mar 2011 23:26:07 +1100</pubDate>
    </item>
    <item>
      <title>[General Questions] transcriptome assembly</title>
      <link>http://www.nucleics.com/forum/read/11/4228/4228.html#msg-4228</link>
      <author>papori</author>
      <description><![CDATA[what is the result of transcriptome assembly?

many contigs as number of the rna molecules?

or one long as the result in genome assembly?

thanks..]]></description>
      <category>General Questions</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/11/4228/4228.html#msg-4228</guid>
      <pubDate>Tue, 08 Mar 2011 00:34:35 +1100</pubDate>
    </item>
    <item>
      <title>[DNA Sequencing Forum] Re: short sequences problem</title>
      <link>http://www.nucleics.com/forum/read/10/2060/4211.html#msg-4211</link>
      <author>Linda Prince</author>
      <description><![CDATA[We too run an AB 3130xl and have had trouble with arrays failing much earlier (150-250 runs) than they did in the past (350-400 runs) for the last couple of arrays.  Is this a recent issue for other users as well?]]></description>
      <category>DNA Sequencing Forum</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/10/2060/4211.html#msg-4211</guid>
      <pubDate>Sun, 20 Feb 2011 16:13:35 +1100</pubDate>
    </item>
    <item>
      <title>[PCR Forum] Can two antisense primers work together</title>
      <link>http://www.nucleics.com/forum/read/12/4207/4207.html#msg-4207</link>
      <author>Adel</author>
      <description><![CDATA[I received a protocol of PCR for KO mice. In the protocol, they use sense primer (CGGTCAACAAACCTACTCAGAATCAGG) and antisense primer (CTGAACTCACATGGAGGCAGGATATAA) for WT identification,and use the same antisense primer (CTGAACTCACATGGAGGCAGGATATAA) with another antisense primer (GAGCGCGCGCGGCGGAGTTGTTGAC) for KO identification. The PCR progress is not going well. Does it make sense to use two antisense primers together?If yes, how it does?
Thank you.]]></description>
      <category>PCR Forum</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/12/4207/4207.html#msg-4207</guid>
      <pubDate>Wed, 16 Feb 2011 07:51:02 +1100</pubDate>
    </item>
    <item>
      <title>[PCR Forum] Re: weird pcr product  ask for help!</title>
      <link>http://www.nucleics.com/forum/read/12/2871/4195.html#msg-4195</link>
      <author>Amanda</author>
      <description><![CDATA[It sounds like this could be a problem with your gel or how the gel was run. Did your standard run the length of the gel or did it stay near the well as well?]]></description>
      <category>PCR Forum</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/12/2871/4195.html#msg-4195</guid>
      <pubDate>Thu, 10 Feb 2011 04:52:29 +1100</pubDate>
    </item>
    <item>
      <title>[DNA Isolation Forum] Buffer ASL and Buffer AL</title>
      <link>http://www.nucleics.com/forum/read/13/4190/4190.html#msg-4190</link>
      <author>JJ</author>
      <description><![CDATA[Dear all,

I would like to know if anyone has ever tried DNA extraction from excrements using QIAamp with Buffer ASL and Buffer AL that was previously incubated at 70°C. Were results significantly different when using these buffers without incubating although they presented precipitates?

Thank you.]]></description>
      <category>DNA Isolation Forum</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/13/4190/4190.html#msg-4190</guid>
      <pubDate>Fri, 04 Feb 2011 23:16:43 +1100</pubDate>
    </item>
    <item>
      <title>[DNA Sequencing Forum] Re: GeXP vs ABI 3500</title>
      <link>http://www.nucleics.com/forum/read/10/3454/4189.html#msg-4189</link>
      <author>niels</author>
      <description><![CDATA[I'm also interested. especially for use in AFLP and MSAFLP work... anyone?]]></description>
      <category>DNA Sequencing Forum</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/10/3454/4189.html#msg-4189</guid>
      <pubDate>Mon, 31 Jan 2011 22:49:27 +1100</pubDate>
    </item>
    <item>
      <title>[PCR Forum] Re: PCR product storage</title>
      <link>http://www.nucleics.com/forum/read/12/409/4188.html#msg-4188</link>
      <author>nucleics</author>
      <description><![CDATA[This is lab forklore, but I can say I have tested it myself and it true.]]></description>
      <category>PCR Forum</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/12/409/4188.html#msg-4188</guid>
      <pubDate>Mon, 31 Jan 2011 11:49:32 +1100</pubDate>
    </item>
    <item>
      <title>[DNA Sequencing Forum] Re: CGG repeat sequencing</title>
      <link>http://www.nucleics.com/forum/read/10/2394/4187.html#msg-4187</link>
      <author>alzenira</author>
      <description><![CDATA[Muchísimas gracias. Me has ayudado mucho.]]></description>
      <category>DNA Sequencing Forum</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/10/2394/4187.html#msg-4187</guid>
      <pubDate>Sun, 30 Jan 2011 23:03:23 +1100</pubDate>
    </item>
    <item>
      <title>[PCR Forum] Re: PCR product storage</title>
      <link>http://www.nucleics.com/forum/read/12/409/4186.html#msg-4186</link>
      <author>Fernando</author>
      <description><![CDATA[Hi, Why the 3' overhangs tends to be removed after long time storage in the freezer? Someone have any paper that say that or is just popular culture? Thanks]]></description>
      <category>PCR Forum</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/12/409/4186.html#msg-4186</guid>
      <pubDate>Sat, 29 Jan 2011 11:08:51 +1100</pubDate>
    </item>
    <item>
      <title>[DNA Sequencing Forum] 3730 capillary array regeneration</title>
      <link>http://www.nucleics.com/forum/read/10/4112/4112.html#msg-4112</link>
      <author>Ayesha</author>
      <description><![CDATA[Hi,

Does anyone have any experience of regenerating 3730 capillary arrays? Is so, can you recommend any method of doing this?

Thanks

A]]></description>
      <category>DNA Sequencing Forum</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/10/4112/4112.html#msg-4112</guid>
      <pubDate>Fri, 14 Jan 2011 01:19:20 +1100</pubDate>
    </item>
    <item>
      <title>[PCR Forum] Re: PCR product storage</title>
      <link>http://www.nucleics.com/forum/read/12/409/4032.html#msg-4032</link>
      <author>nucleics</author>
      <description><![CDATA[Hi Kate

In the fridge short term and in the freezer long term. It is not a good idea to store PCR products if you plan to TA clone - storage seems to remove the 3' A overhang.]]></description>
      <category>PCR Forum</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/12/409/4032.html#msg-4032</guid>
      <pubDate>Wed, 05 Jan 2011 11:30:27 +1100</pubDate>
    </item>
    <item>
      <title>[PCR Forum] Re: PCR product storage</title>
      <link>http://www.nucleics.com/forum/read/12/409/4031.html#msg-4031</link>
      <author>Kate</author>
      <description><![CDATA[Hey,
after PCR how can I storage product?]]></description>
      <category>PCR Forum</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/12/409/4031.html#msg-4031</guid>
      <pubDate>Wed, 05 Jan 2011 00:52:46 +1100</pubDate>
    </item>
    <item>
      <title>[DNA Sequencing Forum] Re: double peaks from base 270, but only for one primer</title>
      <link>http://www.nucleics.com/forum/read/10/4011/4014.html#msg-4014</link>
      <author>nucleics</author>
      <description><![CDATA[This sounds like you have a SNP in your sequence. Since you are sequencing from PCR product you actually have two different PCR products from each allele. If one has a small insertion or deletions in one of the alleles then the sequencing will go out of phase after the point of the SNP.]]></description>
      <category>DNA Sequencing Forum</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/10/4011/4014.html#msg-4014</guid>
      <pubDate>Sat, 01 Jan 2011 09:35:23 +1100</pubDate>
    </item>
    <item>
      <title>[DNA Sequencing Forum] double peaks from base 270, but only for one primer</title>
      <link>http://www.nucleics.com/forum/read/10/4011/4011.html#msg-4011</link>
      <author>PHS</author>
      <description><![CDATA[Dear all,

recently I am running into trouble when sequencing small subunit rDNA from nematode samples using BigDye v3.1 from Exo/Sap or Kit cleaned PCR products. I am sequencing closely related species from one genus, doing two PCR reactions of approximately 900 to 1000 bp each. When sequencing with the forward primers I get high quality reads of good length (up to 680 bases). However, when using the reverse primers this is only true for about half of my PCR products (i.e. half of my species), for the other half the quality drops at around 270 bases (or 370 for the 2nd PCR product). Traces look as if out of phase, or as if there was a second fragment being sequenced along. Needles to say, that I checked the gel for such a second product, bu there isn't any. Also the forward primer wouldn't work fine in that case as well, wouldn't it? Basically the same should be true for secondary structure formation, would affect both primers wouldn't it?
Also I checked for a second priming site within the expected product (i.e. checked in the products that worked), but that doesn't seem to be the case. To make extra sure I made new PCRs and sent them away for sequencing to Macrogen Europe - I get the same results, as when I do the sequencing reaction myself and get the reads from our local seq. center. Albeit the Macrogen reads are a bit better as the bases are called for the whole product (not 'Ns' from 270 onwards), but not reliable as well, as the extra peaks are still there. Well, I've been sequencing small subunit PCR products for the last few years (hundreds and hundreds), but never had this kind of problem. Any help/hints/suggestions would be highly appreciated and I might as well provide more details on my protocols and traces to look at.


Kind regards

PHS]]></description>
      <category>DNA Sequencing Forum</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/10/4011/4011.html#msg-4011</guid>
      <pubDate>Thu, 30 Dec 2010 02:50:39 +1100</pubDate>
    </item>
    <item>
      <title>[PCR Forum] Re: PCR Hint #3 Tm is determined by the lowest primer</title>
      <link>http://www.nucleics.com/forum/read/12/102/3965.html#msg-3965</link>
      <author>Hang tran</author>
      <description><![CDATA[Please explain more clearly about Tm!]]></description>
      <category>PCR Forum</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/12/102/3965.html#msg-3965</guid>
      <pubDate>Thu, 09 Dec 2010 20:05:36 +1100</pubDate>
    </item>
    <item>
      <title>[PCR Forum] Re: melting temperature of the primers</title>
      <link>http://www.nucleics.com/forum/read/12/3931/3955.html#msg-3955</link>
      <author>nucleics</author>
      <description><![CDATA[If you want to make a 54 base oligo just contact a company that makes them and give them the sequence you want. They will make it and ship it to you.]]></description>
      <category>PCR Forum</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/12/3931/3955.html#msg-3955</guid>
      <pubDate>Wed, 24 Nov 2010 23:31:24 +1100</pubDate>
    </item>
  </channel>
</rss>

