<?xml version="1.0" encoding="iso-8859-1" ?>
<rss version="2.0">
  <channel>
    <title>Nucleics Forum</title>
    <link>http://www.nucleics.com/forum/index.php</link>
    <description><![CDATA[]]></description>
    <language>EN</language>
    <pubDate>Thu, 01 May 2008 20:07:12 -0500</pubDate>
    <lastBuildDate>Thu, 01 May 2008 20:07:12 -0500</lastBuildDate>
    <category>Nucleics Forum</category>
    <generator>Phorum 5.1.22</generator>
    <ttl>600</ttl>
    <item>
      <title>[DNA Sequencing Forum] Re: sequencing pcr product or plasmid afrer clonning?</title>
      <link>http://www.nucleics.com/forum/read/10/773/774.html#msg-774</link>
      <author>nucleics</author>
      <description><![CDATA[Hi Debbie

You can sequence the PCR product directly - this is generally much simpler than cloning and sequencing. The only thing you need to do first is remove the leftover primers and dNTP. I would recommend using a PCR product purification kit (there are hundreds out there) to do this. Just make sure that you don't use too much of the PCR product in the sequencing reaction (ie follow the bigdye kit instructions).

Cheers]]></description>
      <category>DNA Sequencing Forum</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/10/773/774.html#msg-774</guid>
      <pubDate>Thu, 01 May 2008 20:07:12 -0500</pubDate>
    </item>
    <item>
      <title>[DNA Sequencing Forum] sequencing pcr product or plasmid afrer clonning?</title>
      <link>http://www.nucleics.com/forum/read/10/773/773.html#msg-773</link>
      <author>debbie</author>
      <description><![CDATA[Hi... I am new in the sequencing and still confuse what method should I use. I want to sequence the gene as in data base. We design primer sets for these sequence and amplify it by pcr. I am now would like to check if I got the right gene and would like to sequence it. My collegue suggest me to clone the pcr product to pGEm then sequence the colonies (plasmid dna from the colony). WHy I should do the clonning before sequencing and can I do direct sequencing from my PCR product? What will make the results different if I do directly from PCR product or clonning?

Thanks....]]></description>
      <category>DNA Sequencing Forum</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/10/773/773.html#msg-773</guid>
      <pubDate>Thu, 01 May 2008 19:13:19 -0500</pubDate>
    </item>
    <item>
      <title>[PCR Forum] Re: PCR product storage</title>
      <link>http://www.nucleics.com/forum/read/12/409/410.html#msg-410</link>
      <author>nucleics</author>
      <description><![CDATA[It depends what the PCR products are stored in. If it is in water it is best to freeze the sample unless you are going to use them within a few hours.

I prefer to use 10/0.1 TE [10mM Tris, 0.1 mM EDTA, pH 8.5] to store my PCR products. The tris helps stop the solution from becoming acidic (cause by CO2 being absorbed from the air) and the small amount of EDTA doesn't interfere with the sequencing reaction. If you use this then you can just store at 4.deg.C. I have found that stored in 10/0.1 TE the PCR products will last for years in the fridge.]]></description>
      <category>PCR Forum</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/12/409/410.html#msg-410</guid>
      <pubDate>Wed, 12 Mar 2008 19:16:45 -0500</pubDate>
    </item>
    <item>
      <title>[PCR Forum] PCR product storage</title>
      <link>http://www.nucleics.com/forum/read/12/409/409.html#msg-409</link>
      <author>Deb</author>
      <description><![CDATA[Once I have a purified PCR product, what temperature is best for storage prior to sequencing?  How long can it be stored at that temp?]]></description>
      <category>PCR Forum</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/12/409/409.html#msg-409</guid>
      <pubDate>Wed, 12 Mar 2008 18:56:19 -0500</pubDate>
    </item>
    <item>
      <title>[General Questions] sequencing trouble for the third time!</title>
      <link>http://www.nucleics.com/forum/read/11/408/408.html#msg-408</link>
      <author>anandi</author>
      <description><![CDATA[I could really do with some help! I have general primers that ought to bind to the cytochrome b mitochondrial gene in bos taurus (cattle). now, the forward sequences have worked alright 2 out of 3 times, the reverse hasn't workerd at all except in one single sample during the very first run!? i know my initial PCR is ok so it has to be the sequencing cleanup or the sequencing pcr reaction. i get either no run at all, just 4 or so unidentified nucleotides or i get huge dye blobs and G due peaks that stretch for many bases. could it be the cleanup step when my forward reactions work well? could it be the primer? some outside thoughts would be appreciated! feel free to E-mail me at s24061621@tuks.co.za

kind regards
anandi]]></description>
      <category>General Questions</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/11/408/408.html#msg-408</guid>
      <pubDate>Thu, 28 Feb 2008 06:39:01 -0600</pubDate>
    </item>
    <item>
      <title>[PCR Forum] Re: Coolant for PCR machines.</title>
      <link>http://www.nucleics.com/forum/read/12/398/399.html#msg-399</link>
      <author>nucleics</author>
      <description><![CDATA[Hi Larry

This is a good question. I do know that that the PE2400 had a major design flaw in regards the cooling unit. I have owned a couple in the past that have had to be fixed (I think one was fixed three time). We just sent them off to be fixed so I have no idea what the coolant used is. I guess you could try using radiator fluid - the worst that could happen is you destroy them :)]]></description>
      <category>PCR Forum</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/12/398/399.html#msg-399</guid>
      <pubDate>Thu, 31 Jan 2008 17:16:24 -0600</pubDate>
    </item>
    <item>
      <title>[PCR Forum] Coolant for PCR machines.</title>
      <link>http://www.nucleics.com/forum/read/12/398/398.html#msg-398</link>
      <author>Larry Reiter</author>
      <description><![CDATA[I just picked up two PE2400 machines, but they are having cooling problems.  One has no coolant in it.  What type of coolant should I use?  Is this just radiator coolant?

Thanks in advance.

LTR]]></description>
      <category>PCR Forum</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/12/398/398.html#msg-398</guid>
      <pubDate>Thu, 31 Jan 2008 16:52:32 -0600</pubDate>
    </item>
    <item>
      <title>[DNA Sequencing Forum] Re: sequencing problem</title>
      <link>http://www.nucleics.com/forum/read/10/385/387.html#msg-387</link>
      <author>BARTman</author>
      <description><![CDATA[Thanks for your quick reply. This problem always occurs at the end of the sequence. A profile has been sent by email.
Regards,]]></description>
      <category>DNA Sequencing Forum</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/10/385/387.html#msg-387</guid>
      <pubDate>Fri, 04 Jan 2008 02:01:47 -0600</pubDate>
    </item>
    <item>
      <title>[DNA Sequencing Forum] Re: sequencing problem</title>
      <link>http://www.nucleics.com/forum/read/10/385/386.html#msg-386</link>
      <author>nucleics</author>
      <description><![CDATA[It sounds like it might be a signal spike caused by an air bubble in the capillary. Take a look at this page http://www.nucleics.com/DNA_sequencing_support/DNA-sequencing-sharp-spikes.html

If you send me the trace I will take a look at it and let you know.

Cheers]]></description>
      <category>DNA Sequencing Forum</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/10/385/386.html#msg-386</guid>
      <pubDate>Thu, 03 Jan 2008 22:12:48 -0600</pubDate>
    </item>
    <item>
      <title>[DNA Sequencing Forum] sequencing problem</title>
      <link>http://www.nucleics.com/forum/read/10/385/385.html#msg-385</link>
      <author>BARTman</author>
      <description><![CDATA[Recently, we upgraded our Applied Biosystems (ABI)3100 DNA Sequencer to an ABI3130XL system. We are sequencing with 50cm capillaries and POP7 polymer. 

When running sequencing reactions (BigDye v3.1), we generate profiles with following characteristic: at the end of the sequence we often registrate an A-peak with (very) strong intensity &gt;&gt; the more when sequence length is shorter. This problem is observed with XTerminator and other purification technologies.

Do you have any explanation for this?]]></description>
      <category>DNA Sequencing Forum</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/10/385/385.html#msg-385</guid>
      <pubDate>Thu, 03 Jan 2008 07:34:06 -0600</pubDate>
    </item>
    <item>
      <title>[PCR Forum] Re: Is it ok?!</title>
      <link>http://www.nucleics.com/forum/read/12/375/377.html#msg-377</link>
      <author>senthil.impres</author>
      <description><![CDATA[Thanks a lot daniel! I would make it that way.]]></description>
      <category>PCR Forum</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/12/375/377.html#msg-377</guid>
      <pubDate>Thu, 06 Dec 2007 08:44:31 -0600</pubDate>
    </item>
    <item>
      <title>[PCR Forum] Re: Is it ok?!</title>
      <link>http://www.nucleics.com/forum/read/12/375/376.html#msg-376</link>
      <author>nucleics</author>
      <description><![CDATA[The primers really should be closer in Tm than what you have. I suggest that you try making your antisense primer shorter to bring down it's Tm.]]></description>
      <category>PCR Forum</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/12/375/376.html#msg-376</guid>
      <pubDate>Thu, 06 Dec 2007 06:37:57 -0600</pubDate>
    </item>
    <item>
      <title>[PCR Forum] Is it ok?!</title>
      <link>http://www.nucleics.com/forum/read/12/375/375.html#msg-375</link>
      <author>senthil.impres</author>
      <description><![CDATA[Hi folks,

 I am new to the area of PCR cloning and am trying to amplify a 3000bp region from a plasmid construct. I use Invitrogen VectorNTI's (amplify selection) method to design a primer. What i get now is primers of 20bp length (both sense and antisense)with these calculated values
   Contains region of the molecule from 13 to 3001
      Tm: 80.7 C  TaOpt: 55.3 C  GC: 51.3
    Sense Primer: 
      TAACTGGTTTCCTGAAAGGT
      Similarity: 100.0%
      Length: 20  Tm: 45.6 C  GC: 40.0
      dH: -150.2 kcal/mol  dS: -394.6 cal/mol  dG: -30.8 kcal/mol
    Antisense Primer: 
      CCCATTCCAGCGCCAGGAGC
      Similarity: 100.0%
      Length: 20  Tm: 63.4 C  GC: 70.0
      dH: -169.9 kcal/mol  dS: -427.7 cal/mol  dG: -40.6 kcal/mol
    Tm Difference: 17.8
    GC Difference: 30.0

Is this alright to go with? or should i play around these values. Suggestions are very much appreciated. Thanks in advance]]></description>
      <category>PCR Forum</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/12/375/375.html#msg-375</guid>
      <pubDate>Thu, 06 Dec 2007 03:07:12 -0600</pubDate>
    </item>
    <item>
      <title>[RNA Isolation Forum] RNA isolation from actinomyces</title>
      <link>http://www.nucleics.com/forum/read/14/369/369.html#msg-369</link>
      <author>Mike Wilson</author>
      <description><![CDATA[I am trying to isolate RNA from a high GC, gram positive, marine actinomyces and I am consistently getting low yields. I have tried several kits. I feel my problem lies in the cell disruption step. I am using the Ribopure Bacteria Kit from Ambion now and I have extended the bead beating step out to 30 min. I have also tried grinding the cells under liquid nitrogen in a 1.5 ml tube. My yields have improved with the bead beating extended but they are still sub-par for my needs. Any suggestions?]]></description>
      <category>RNA Isolation Forum</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/14/369/369.html#msg-369</guid>
      <pubDate>Wed, 14 Nov 2007 11:25:13 -0600</pubDate>
    </item>
    <item>
      <title>[PeakTrace Basecaller Forum] PeakTrace for MegaBACE recent developments</title>
      <link>http://www.nucleics.com/forum/read/21/365/365.html#msg-365</link>
      <author>nucleics</author>
      <description><![CDATA[We have started working on a version of PeakTrace designed for the MegaBACE sequencers. So far things are looking good and we have a version that will process traces generated with the ET terminators. If you are interested in trying this version please contact us.]]></description>
      <category>PeakTrace Basecaller Forum</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/21/365/365.html#msg-365</guid>
      <pubDate>Tue, 23 Oct 2007 21:27:48 -0500</pubDate>
    </item>
    <item>
      <title>[PeakTrace Basecaller Forum] PeakTrace v1.11</title>
      <link>http://www.nucleics.com/forum/read/21/363/363.html#msg-363</link>
      <author>nucleics</author>
      <description><![CDATA[Update to PeakTrace v1.11

A couple of updates to PeakTrace.

1. PeakTrace now handles traces with significant inter-channel signal intensity differences (ie traces where one or more channels were much stronger than the others). Previous these traces gave a spacing model error.

2. A new processing option has been introduced that allows either the original KB basecalling start point or the secondary start point to be selected for PeakTrace basecalling. This feature allows poor quality signal at the front of the trace to be clipped (eg removing problems caused by dye blobs).]]></description>
      <category>PeakTrace Basecaller Forum</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/21/363/363.html#msg-363</guid>
      <pubDate>Thu, 27 Sep 2007 06:42:50 -0500</pubDate>
    </item>
    <item>
      <title>[LongTrace Forum] Re: how does long-trace work?</title>
      <link>http://www.nucleics.com/forum/read/3/336/355.html#msg-355</link>
      <author>nucleics</author>
      <description><![CDATA[Hi Mira

If your trace is giving &quot;weak or failed&quot; traces at the end it means that the signal at the end of the trace is too low to be improved by LongTrace. I can't really tell you much more without seeing you trace, but if you open you trace in a trace viewing program like FinchTV you can have a look at the signal at the end of the trace. You need to look at the raw data as this is what LongTrace uses to do the basecalling. If the peak signal at the end of the trace is very weak (basically flat) then LongTrace is not able to do much to improve the basecall.

A trace file is just the ab1 file that contains the sequence data peaks. I don't really know why they are called trace files - I guess there is some sort of historical reason for it.

The free service has a limit of 10 files per day - it is really only for tiny users and people wanting to try LongTrace. If you want to process more files then this you need to register for LongTrace FTP. The link to regester is here

[url=https://www.nucleics.com/longtrace/user-app.php]LongTrace Registration[/url]

Finally, have you tried PeakTrace too? Sometimes it is able to improve traces that can't be improved by LongTrace. The link for the free PeakTrace version is here:

[url=http://www.nucleics.com/peaktrace-sequencing/]Free PeakTrace Basecaller[/url]

Cheers]]></description>
      <category>LongTrace Forum</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/3/336/355.html#msg-355</guid>
      <pubDate>Thu, 20 Sep 2007 02:33:50 -0500</pubDate>
    </item>
    <item>
      <title>[LongTrace Forum] Weak or failed trace</title>
      <link>http://www.nucleics.com/forum/read/3/336/352.html#msg-352</link>
      <author>mira</author>
      <description><![CDATA[Hi!
  I tried putting my sequences for the free LongTrace DNA sequencing service. My seq were in the correct ab1 format but i only got this reply 'Weak or failed trace'. Can you help me out? For your info, the sequences i put in is about 800 bp in length.
   Also can you explain a bit about the 10 trace limit per person? What does the term 'trace' refer to?
    I'm rather new at this and i'de like to understand more if its not too much trouble.

Thank you :)]]></description>
      <category>LongTrace Forum</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/3/336/352.html#msg-352</guid>
      <pubDate>Thu, 20 Sep 2007 01:40:43 -0500</pubDate>
    </item>
    <item>
      <title>[LongTrace:Box Forum] Re: LongTrace:Box released</title>
      <link>http://www.nucleics.com/forum/read/20/90/349.html#msg-349</link>
      <author>nucleics</author>
      <description><![CDATA[We have place the help manual for the LongTrace:Box system online here: 

[url=https://www.nucleics.com/longtrace/auto-longtrace-manual.html] LongTrace:Box help manual[/url]]]></description>
      <category>LongTrace:Box Forum</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/20/90/349.html#msg-349</guid>
      <pubDate>Sun, 16 Sep 2007 19:55:21 -0500</pubDate>
    </item>
    <item>
      <title>[LongTrace:Box Forum] Re: Beta ABI 3700 trace processing support</title>
      <link>http://www.nucleics.com/forum/read/20/103/348.html#msg-348</link>
      <author>nucleics</author>
      <description><![CDATA[We recommend that ABI 3700 uses use PeakTrace rather than LongTrace as PeakTrace not only offers better basecalling but supports a wide rang of chemistries and POP types.]]></description>
      <category>LongTrace:Box Forum</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/20/103/348.html#msg-348</guid>
      <pubDate>Sun, 16 Sep 2007 19:52:45 -0500</pubDate>
    </item>
    <item>
      <title>[CounterTrace Forum] Re: Why use CounterTrace instead of LongTrace?</title>
      <link>http://www.nucleics.com/forum/read/6/78/342.html#msg-342</link>
      <author>nucleics</author>
      <description><![CDATA[I should now add that we know recommend using our PeakTrace software as it has much better supports for the ABI 3700 sequencer than LongTrace. It also supports the really old ABI sequencers like the ABI310 and ABI377. You can find out  more about the [url=https://www.nucleics.com/peaktrace/]PeakTrace basecaller[/url] is you are interest in try it.]]></description>
      <category>CounterTrace Forum</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/6/78/342.html#msg-342</guid>
      <pubDate>Thu, 13 Sep 2007 20:31:29 -0500</pubDate>
    </item>
    <item>
      <title>[LongTrace Forum] Re: how does long-trace work?</title>
      <link>http://www.nucleics.com/forum/read/3/336/341.html#msg-341</link>
      <author>nucleics</author>
      <description><![CDATA[Hi Resnanti

How LongTrace works is a trade secret, but in general terms it does the same type of processing that ABI's software does only we are better at it than ABI. I know these seems strange as the guys at ABI are pretty smart. I suspect the ABI management doesn't think it is a priority to improve the processing of their own traces and hence the software people there don't work on it. 

In the end it doesn't really matter - what matters is does LongTrace improve your own traces and the best of finding that out is trying our free [url=http://www.nucleics.com/longtrace-sequencing/]LongTrace DNA sequencing service[/url]. Hopefully you will like what you see :)

You might also want to check out our new basecaller PeakTrace. This works much like LongTrace, but on a wider range of machines (it can even improve ABI 377 trace). You can also try it for free at the [url=http://www.nucleics.com/peaktrace-sequencing/]PeakTrace DNA sequencing basecaller[/url] page.]]></description>
      <category>LongTrace Forum</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/3/336/341.html#msg-341</guid>
      <pubDate>Thu, 13 Sep 2007 20:21:55 -0500</pubDate>
    </item>
    <item>
      <title>[LongTrace Forum] how does long-trace work?</title>
      <link>http://www.nucleics.com/forum/read/3/336/336.html#msg-336</link>
      <author>resnanti</author>
      <description><![CDATA[i wonder how does long trace software work with ab1 file? thx]]></description>
      <category>LongTrace Forum</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/3/336/336.html#msg-336</guid>
      <pubDate>Tue, 04 Sep 2007 02:50:36 -0500</pubDate>
    </item>
    <item>
      <title>[LongTrace Forum] LongTrace FTP usage reporting update</title>
      <link>http://www.nucleics.com/forum/read/3/335/335.html#msg-335</link>
      <author>nucleics</author>
      <description><![CDATA[We have updates the usage reports to make it a little easier to understand how many traces you have processed and how many processing units remain. 

You can access your usage report by logging in to the main LongTrace page and entering your ftp user name and password in the login box.]]></description>
      <category>LongTrace Forum</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/3/335/335.html#msg-335</guid>
      <pubDate>Mon, 03 Sep 2007 19:14:57 -0500</pubDate>
    </item>
    <item>
      <title>[PeakTrace Basecaller Forum] Re: PeakTrace Upgrade v1.07</title>
      <link>http://www.nucleics.com/forum/read/21/329/334.html#msg-334</link>
      <author>nucleics</author>
      <description><![CDATA[Hi Ron

That would be great. I will email you directly about this as I really would like to add BigDye 1.1 support to PeakTrace.]]></description>
      <category>PeakTrace Basecaller Forum</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/21/329/334.html#msg-334</guid>
      <pubDate>Mon, 03 Sep 2007 02:18:04 -0500</pubDate>
    </item>
    <item>
      <title>[PeakTrace Basecaller Forum] PeakTrace v1.09</title>
      <link>http://www.nucleics.com/forum/read/21/333/333.html#msg-333</link>
      <author>nucleics</author>
      <description><![CDATA[New Features in PeakTrace 1.09:

* PeakTrace now outputs .phd.1 and .seq files in addition to .ab1 or .scf files.

* PeakTrace can now handle traces with .ab1 or .abi (ABI 377 traces) file extensions.

* Trace folders can be upload to PeakTrace FTP in either .zip or .7z format. We recommend using the 7zip (www.7zip.org) .7z format as the compression for .ab1 traces is about 60% greater than gzip or bzip2.

* Corrupt or invalid trace files are now moved to the user's &quot;out&quot; folder on the server. This prevents the user receiving more than one email informing them that their files are invalid.]]></description>
      <category>PeakTrace Basecaller Forum</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/21/333/333.html#msg-333</guid>
      <pubDate>Mon, 03 Sep 2007 02:12:58 -0500</pubDate>
    </item>
    <item>
      <title>[PeakTrace Basecaller Forum] Re: PeakTrace Upgrade v1.07</title>
      <link>http://www.nucleics.com/forum/read/21/329/332.html#msg-332</link>
      <author>Ron Burns</author>
      <description><![CDATA[Hi Daniel,

I just noticed this message. I have one customer who we have done a lot   of sequencing for who uses Big DYE V1.1. If you need data I could contact them and ask if they would be willing to let you use their data for testing. Let me know.


Thank you,

Ron Burns]]></description>
      <category>PeakTrace Basecaller Forum</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/21/329/332.html#msg-332</guid>
      <pubDate>Wed, 29 Aug 2007 11:26:51 -0500</pubDate>
    </item>
    <item>
      <title>[LongTrace:Box Forum] Re: Is there a linux version of the longtrace box?</title>
      <link>http://www.nucleics.com/forum/read/20/111/331.html#msg-331</link>
      <author>nucleics</author>
      <description><![CDATA[We have certainly heard of phred, however, phred is just a basecaller and doesn't offer the same readlengths as either KB or LongTrace. In rather good news we have developed a new basecaller (PeakTrace) that combines the advantages of LongTrace and avoids the need to use KB. We have written PeakTrace so that it can be easily ported to Linux. So far we haven't had any paying demand for a Linux version, but hopefully in the future this will allow us to get away from Windows :)]]></description>
      <category>LongTrace:Box Forum</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/20/111/331.html#msg-331</guid>
      <pubDate>Wed, 22 Aug 2007 19:59:49 -0500</pubDate>
    </item>
    <item>
      <title>[LongTrace Forum] Re: LongTrace for 3700 released</title>
      <link>http://www.nucleics.com/forum/read/3/105/330.html#msg-330</link>
      <author>nucleics</author>
      <description><![CDATA[If you are interested in using LongTrace for the 3700 we suggest you check out our PeakTrace service as it performs much better on 3700 traces than LongTrace does.]]></description>
      <category>LongTrace Forum</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/3/105/330.html#msg-330</guid>
      <pubDate>Mon, 20 Aug 2007 02:51:00 -0500</pubDate>
    </item>
    <item>
      <title>[PeakTrace Basecaller Forum] PeakTrace Upgrade v1.07</title>
      <link>http://www.nucleics.com/forum/read/21/329/329.html#msg-329</link>
      <author>nucleics</author>
      <description><![CDATA[We have upgrade the PeakTrace basecalling of ABI 377 traces. The results are rather astounding (even for me) - we even have one 377 trace which gives over 1000 Q20+ bases!

At this stage support of ABI 377 traces is limited to the BigDyeV3.1 chemistry. If you are using BigDye v1.1 please contact us as the reason for our inability to support BigDyev1.1 is we do not have any example ABI 377 traces using this chemistry to train the software.]]></description>
      <category>PeakTrace Basecaller Forum</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/21/329/329.html#msg-329</guid>
      <pubDate>Fri, 10 Aug 2007 04:20:28 -0500</pubDate>
    </item>
  </channel>
</rss>
