<?xml version="1.0" encoding="iso-8859-1" ?>
<rss version="2.0">
  <channel>
    <title>DNA Sequencing Forum</title>
    <link>http://www.nucleics.com/forum/list/10.html</link>
    <description><![CDATA[Help and advice for improving DNA sequencing]]></description>
    <language>EN</language>
    <pubDate>Sat, 17 Jul 2010 20:39:13 -0400</pubDate>
    <lastBuildDate>Sat, 17 Jul 2010 20:39:13 -0400</lastBuildDate>
    <category>DNA Sequencing Forum</category>
    <generator>Phorum 5.1.22</generator>
    <ttl>600</ttl>
    <item>
      <title>Re: different sequences/same site</title>
      <link>http://www.nucleics.com/forum/read/10/3712/3713.html#msg-3713</link>
      <author>nucleics</author>
      <description><![CDATA[Without seeing the traces it is hard to comment.]]></description>
      <category>DNA Sequencing Forum</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/10/3712/3713.html#msg-3713</guid>
      <pubDate>Sat, 17 Jul 2010 20:39:13 -0400</pubDate>
    </item>
    <item>
      <title>different sequences/same site</title>
      <link>http://www.nucleics.com/forum/read/10/3712/3712.html#msg-3712</link>
      <author>Tom</author>
      <description><![CDATA[Hi,
I encountered 2 interesting sequencing problems:)

First- In case of one PCR product, forward and reverse primers give me a different nucleotide in certain position. I mean that sequencing with forward primer gives for example A and sequencing with reverse primer gives for example G in the same position. The rest of the sequence is identical. It is not an accident, I repeated PCR and sequencing several times and it was the same all the time. All forwards say A and all reverses say G. The chromatogram looks good, no mixed peaks. 

The second mysterious error is quite similar. 
The sequence from reverse primer looks like that: TTT 
and the sequence from forward looks like that:    -TT 
Peaks surrounding that region are of the good quality  and  they look good and clear in that region too. And again...I repeated PCR and sequencing and the error persisted. How can I know if the true sequence is TTT or just TT? 

Do you have any suggestions? I do not know how to decide about the true sequence in these two cases. Thank you.]]></description>
      <category>DNA Sequencing Forum</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/10/3712/3712.html#msg-3712</guid>
      <pubDate>Sat, 17 Jul 2010 19:48:43 -0400</pubDate>
    </item>
    <item>
      <title>ABI sequencing</title>
      <link>http://www.nucleics.com/forum/read/10/3520/3520.html#msg-3520</link>
      <author>Jennco</author>
      <description><![CDATA[I am trying to do sequencing for the first time in my lab. We normally only run fragment analysis. We are using the Applied Biosystems 50cm capillary. Does anyone have any experience with them. The manual says 100 runs but when we are doing fragment analysis we can usually get about 400 runs with out sacrificing quality.]]></description>
      <category>DNA Sequencing Forum</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/10/3520/3520.html#msg-3520</guid>
      <pubDate>Tue, 29 Jun 2010 13:35:01 -0400</pubDate>
    </item>
    <item>
      <title>Re: short sequences problem</title>
      <link>http://www.nucleics.com/forum/read/10/2060/3519.html#msg-3519</link>
      <author>Bernie</author>
      <description><![CDATA[Hi Daniel,
With regard to cleaning capillaries,I would be interested in your protocol for that. We use the 3130xl automated sequencer. After approx 150 runs we buy new capillaries. Does this cleaning protocol extend their life beyond that? 

best wishes
Bernie]]></description>
      <category>DNA Sequencing Forum</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/10/2060/3519.html#msg-3519</guid>
      <pubDate>Tue, 29 Jun 2010 06:35:42 -0400</pubDate>
    </item>
    <item>
      <title>what are the disadvantages of SR(split read) method in sequencing and how to avoid these disadvantages?</title>
      <link>http://www.nucleics.com/forum/read/10/3455/3455.html#msg-3455</link>
      <author>zengxi</author>
      <description><![CDATA[SR(split read) method is popular now. But SR also will arrive at many wrong results,that is to say, wrong indels such as wrong deletion site or quantity and  wrong insertion site or quantity. I wonder what's the distanvages  of SR and how to avoid these disadvantages.I really appreciate it if anyone help me solve this problem, thank you!]]></description>
      <category>DNA Sequencing Forum</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/10/3455/3455.html#msg-3455</guid>
      <pubDate>Thu, 10 Jun 2010 08:48:33 -0400</pubDate>
    </item>
    <item>
      <title>GeXP vs ABI 3500</title>
      <link>http://www.nucleics.com/forum/read/10/3454/3454.html#msg-3454</link>
      <author>varvara</author>
      <description><![CDATA[I am interested in the performance and the price of sequencing per sample for both machines.

Many thanks]]></description>
      <category>DNA Sequencing Forum</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/10/3454/3454.html#msg-3454</guid>
      <pubDate>Wed, 09 Jun 2010 16:02:31 -0400</pubDate>
    </item>
    <item>
      <title>Re: Strange looking chromatogram</title>
      <link>http://www.nucleics.com/forum/read/10/2950/2952.html#msg-2952</link>
      <author>nucleics</author>
      <description><![CDATA[Send me the trace file and I will take a look at it.]]></description>
      <category>DNA Sequencing Forum</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/10/2950/2952.html#msg-2952</guid>
      <pubDate>Fri, 05 Mar 2010 05:13:36 -0500</pubDate>
    </item>
    <item>
      <title>Strange looking chromatogram</title>
      <link>http://www.nucleics.com/forum/read/10/2950/2950.html#msg-2950</link>
      <author>Amy Chin</author>
      <description><![CDATA[Hi again,

In our recent sequencing runs, we noticed that the chromatograms of a few samples had peaks that overlap a little, which could be an indication that the capillary is going bad. It's not all the samples, and the incidence seems pretty random. 

We're not sure what the real problem is, so if anyone can help, I can send the chromatogram over. Thanks!]]></description>
      <category>DNA Sequencing Forum</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/10/2950/2950.html#msg-2950</guid>
      <pubDate>Fri, 05 Mar 2010 02:11:20 -0500</pubDate>
    </item>
    <item>
      <title>Re: Mixed signal in the middle of sequencing trace</title>
      <link>http://www.nucleics.com/forum/read/10/2790/2949.html#msg-2949</link>
      <author>Amy Chin</author>
      <description><![CDATA[nucleics Wrote:
-------------------------------------------------------
&gt; This sound like an indel. Are you sequencing PCR
&gt; products from a heterozygous individual?

Yes. We finally understood why we got these results are you're right indeed. It was a heterozygous individual. Thanks!]]></description>
      <category>DNA Sequencing Forum</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/10/2790/2949.html#msg-2949</guid>
      <pubDate>Fri, 05 Mar 2010 02:05:06 -0500</pubDate>
    </item>
    <item>
      <title>Re: AppliedBiosystems vs Beckman-Coulter</title>
      <link>http://www.nucleics.com/forum/read/10/2839/2935.html#msg-2935</link>
      <author>Bill</author>
      <description><![CDATA[Hi there.

Can I suggest a third option?
Did you ever considered buying a refurbished instrument? Maybe a 3130 or even a 3730.

Cheers 

Bill]]></description>
      <category>DNA Sequencing Forum</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/10/2839/2935.html#msg-2935</guid>
      <pubDate>Sat, 20 Feb 2010 09:05:07 -0500</pubDate>
    </item>
    <item>
      <title>AppliedBiosystems vs Beckman-Coulter</title>
      <link>http://www.nucleics.com/forum/read/10/2839/2839.html#msg-2839</link>
      <author>genomer</author>
      <description><![CDATA[Hi people!

Will somebody help me to make right choice?
The problem is like that: I'm going to get sequencer for my genotyping laboratory and I've got 2 options to choose between - ABI 3500 and GenomeLab (from Beckman).

So which one would you recommend to obtain?

Some people say that GenomeLab uses the chemistry that is too fastidious in terms of PCR product purity - due to (probably) poor ability of Beckman proprietary Taq polymerase to incorporate ddNTPs.
That is in contrast to nearly completely &quot;adjusted&quot; Taq polymerase produced by Applied Biosystems.
Again, these are only rumours.

So, does anybody know anything more precise about all this stuff?

Thank you in advance!]]></description>
      <category>DNA Sequencing Forum</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/10/2839/2839.html#msg-2839</guid>
      <pubDate>Wed, 23 Dec 2009 13:44:45 -0500</pubDate>
    </item>
    <item>
      <title>genomic DNA sequence</title>
      <link>http://www.nucleics.com/forum/read/10/2808/2808.html#msg-2808</link>
      <author>Kalpataru Halder</author>
      <description><![CDATA[I have faced the problem about genomic DNA sequence. When I have used the genomic DNA as template, no signal was obtained. How much template should I use for successful reaction?]]></description>
      <category>DNA Sequencing Forum</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/10/2808/2808.html#msg-2808</guid>
      <pubDate>Fri, 04 Dec 2009 11:38:21 -0500</pubDate>
    </item>
    <item>
      <title>Re: Mixed signal in the middle of sequencing trace</title>
      <link>http://www.nucleics.com/forum/read/10/2790/2805.html#msg-2805</link>
      <author>nucleics</author>
      <description><![CDATA[This sound like an indel. Are you sequencing PCR products from a heterozygous individual?]]></description>
      <category>DNA Sequencing Forum</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/10/2790/2805.html#msg-2805</guid>
      <pubDate>Thu, 03 Dec 2009 00:50:07 -0500</pubDate>
    </item>
    <item>
      <title>Mixed signal in the middle of sequencing trace</title>
      <link>http://www.nucleics.com/forum/read/10/2790/2790.html#msg-2790</link>
      <author>Amy Chin</author>
      <description><![CDATA[I have encountered a situation in which a sequencing trace is of good quality and has single peaks but halfway through (about 200bp), the peaks suddenly become mixed (&quot;peak under peak&quot;) all the way to the end. This was observed in a few other samples of the same sequencing batch. What could have been the problem? Thank you in advance.]]></description>
      <category>DNA Sequencing Forum</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/10/2790/2790.html#msg-2790</guid>
      <pubDate>Tue, 10 Nov 2009 04:05:09 -0500</pubDate>
    </item>
    <item>
      <title>Re: Good 1 Kb PCR product but bad sequencing results</title>
      <link>http://www.nucleics.com/forum/read/10/2599/2698.html#msg-2698</link>
      <author>nucleics</author>
      <description><![CDATA[This can happen if you have not removed all the PCR primers from the reaction. Also you can have mis-annealing products in the reactions. You can't see these on the gel, but in total they will ruin your sequencing reaction.

The solution is to use internal primers for the sequencing reaction. it is never a good idea to use the same primers you use for amplification for sequencing PCR products.]]></description>
      <category>DNA Sequencing Forum</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/10/2599/2698.html#msg-2698</guid>
      <pubDate>Tue, 08 Sep 2009 09:49:23 -0400</pubDate>
    </item>
    <item>
      <title>Re: CGG repeat sequencing</title>
      <link>http://www.nucleics.com/forum/read/10/2394/2604.html#msg-2604</link>
      <author>nucleics</author>
      <description><![CDATA[Hi Alzenira

There are a couple of things you can do:

1. Incorporate 7-deaza-dGTP into the PCR you use the PCR amplify the FMR1 gene. This reduces the binding energy of the GC pairs and so makes it easier to sequence.

2. Add Betaine (~1M) to the sequencing reaction. This will help melt the 

3. Use a mix of BigDye 3.1 and the dye rodamine chemistry. From memory the ration should be 1:4.]]></description>
      <category>DNA Sequencing Forum</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/10/2394/2604.html#msg-2604</guid>
      <pubDate>Tue, 21 Jul 2009 17:33:40 -0400</pubDate>
    </item>
    <item>
      <title>Re: Sequncing result for agrobacterium plasmid</title>
      <link>http://www.nucleics.com/forum/read/10/2590/2603.html#msg-2603</link>
      <author>nucleics</author>
      <description><![CDATA[Sequencing of low copy plasmids can be difficult. What I would recommend is PCR amplifying the region you want to sequence and then sequence the PCR product directly.]]></description>
      <category>DNA Sequencing Forum</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/10/2590/2603.html#msg-2603</guid>
      <pubDate>Tue, 21 Jul 2009 17:29:04 -0400</pubDate>
    </item>
    <item>
      <title>Re: sequencing long PCR fragment</title>
      <link>http://www.nucleics.com/forum/read/10/2583/2602.html#msg-2602</link>
      <author>nucleics</author>
      <description><![CDATA[Hi Jelena

You shouldn't need a internal primer if you run your traces through our free LongTrace or PeakTrace software. This should increase the read length over 1000 bases and will give you enough good sequence to get the entire 1600 bases with only the two end reads.]]></description>
      <category>DNA Sequencing Forum</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/10/2583/2602.html#msg-2602</guid>
      <pubDate>Tue, 21 Jul 2009 17:27:10 -0400</pubDate>
    </item>
    <item>
      <title>Re: sequencing long PCR fragment</title>
      <link>http://www.nucleics.com/forum/read/10/2583/2601.html#msg-2601</link>
      <author>Chromous Sequencing</author>
      <description><![CDATA[Hi Jelena,

The 1600 bp PCR fragment has to be first sequenced using the forward and reverse PCR primers followed by a 3rd primer designed based on either the forward or reverse data and finally the data has to be aligned.]]></description>
      <category>DNA Sequencing Forum</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/10/2583/2601.html#msg-2601</guid>
      <pubDate>Tue, 21 Jul 2009 09:35:24 -0400</pubDate>
    </item>
    <item>
      <title>Good 1 Kb PCR product but bad sequencing results</title>
      <link>http://www.nucleics.com/forum/read/10/2599/2599.html#msg-2599</link>
      <author>Asif Ullah</author>
      <description><![CDATA[I am using CEQ 8000 genetic analyzer of BEckman coulter. some time i got good PCR amplification band on agarose gel. but sequencing results of that product with same primers appear very bad and most of the time even fail to sequence. what is the possible reason and what can be the possible solution. ?
please reply.

Asif Ullah Khan]]></description>
      <category>DNA Sequencing Forum</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/10/2599/2599.html#msg-2599</guid>
      <pubDate>Sun, 19 Jul 2009 07:32:58 -0400</pubDate>
    </item>
    <item>
      <title>Sequncing result for agrobacterium plasmid</title>
      <link>http://www.nucleics.com/forum/read/10/2590/2590.html#msg-2590</link>
      <author>Jason</author>
      <description><![CDATA[Hi,

Previously I cloned my sequence into agrobacterium plasmid as later on I need to use it to infect my plants.  But when I extracted the agrobacterium plasmid and sent it for sequencing, the result was terrible.  The technician told me it was due to the RNA contamination.  So, the second time I used an extraction kit to extract the plasmid and send it for second time sequencing.  But this time, the result is worse.  Can anyone help me? I can send you the sequencing for viewing if you want to.  Thanks.]]></description>
      <category>DNA Sequencing Forum</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/10/2590/2590.html#msg-2590</guid>
      <pubDate>Sat, 11 Jul 2009 09:16:11 -0400</pubDate>
    </item>
    <item>
      <title>sequencing long PCR fragment</title>
      <link>http://www.nucleics.com/forum/read/10/2583/2583.html#msg-2583</link>
      <author>jelena</author>
      <description><![CDATA[Hi, 

we want to sequencing 1600 bp PCR fragment but we only have 50 cm capillary and pop-7. Can we sequencing with this?]]></description>
      <category>DNA Sequencing Forum</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/10/2583/2583.html#msg-2583</guid>
      <pubDate>Wed, 08 Jul 2009 08:05:31 -0400</pubDate>
    </item>
    <item>
      <title>Re: troubleshoot, help please</title>
      <link>http://www.nucleics.com/forum/read/10/2496/2500.html#msg-2500</link>
      <author>nucleics</author>
      <description><![CDATA[It is really hard to offer help without looking at some example traces. Contact me by email and I will be better able to help.]]></description>
      <category>DNA Sequencing Forum</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/10/2496/2500.html#msg-2500</guid>
      <pubDate>Thu, 07 May 2009 20:09:38 -0400</pubDate>
    </item>
    <item>
      <title>troubleshoot, help please</title>
      <link>http://www.nucleics.com/forum/read/10/2496/2496.html#msg-2496</link>
      <author>Jennifer</author>
      <description><![CDATA[I have encountered a few sequencing problems recently.  I sequenced the same PCR product (after exoSAP cleanup) in both the Forward direction and Reverse directions that are done in SEPARATE plates.  Forward sequence in okay, but there is about 10 to 30 bases that are not sequenced well on the Reverse direction.  It first become extremely slanted, and then it becomes &quot;double peak&quot;, for example, for location expected one T, it becomes two T, for locations expecting 3 A, it becomes 4 A.  

Another weird thing is that the &quot;bad chunks&quot; seems to be around the same region across different samples.  I did think about secondary structure, but we have sequenced the same region using the same method previously and this problem just comes up recently.  For that, I also ruled out things like annealing temperature, primer design. 

Another problem I encountered is premature stop.  Recently, most forward reactions stop prematurely after 200 bases (where usually it goes up to 700 to even 900 bases).  

Anyone has a clue about the cause of the problems?

Many thanks.]]></description>
      <category>DNA Sequencing Forum</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/10/2496/2496.html#msg-2496</guid>
      <pubDate>Thu, 07 May 2009 17:37:58 -0400</pubDate>
    </item>
    <item>
      <title>CGG repeat sequencing</title>
      <link>http://www.nucleics.com/forum/read/10/2394/2394.html#msg-2394</link>
      <author>Alzenira Costa Martins</author>
      <description><![CDATA[I am trying to sequence the FMR1 gene. My first PCR is OK but I have a problem to get a satisfactory result in the second PCR. Does anyone knows a sequencing protocol that works with hight CGG repeats zone? 
Thank you.]]></description>
      <category>DNA Sequencing Forum</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/10/2394/2394.html#msg-2394</guid>
      <pubDate>Fri, 13 Mar 2009 08:59:47 -0400</pubDate>
    </item>
    <item>
      <title>Resolution loss problem?</title>
      <link>http://www.nucleics.com/forum/read/10/2328/2328.html#msg-2328</link>
      <author>ingenu3</author>
      <description><![CDATA[Hi there,
In the recent months I have been encountering Resolution loss results with the ABI3730. 
I am suspecting the cappilary is clogged. The water wash function do not work and i have tried changing the polymer as well but it doesnt work. Is there other way to solve this issue? Or is there another methods that I could try besides changing the cappilary?

Regards,
Zhi]]></description>
      <category>DNA Sequencing Forum</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/10/2328/2328.html#msg-2328</guid>
      <pubDate>Thu, 29 Jan 2009 02:16:55 -0500</pubDate>
    </item>
    <item>
      <title>Re: ABI 3700 sequencer software</title>
      <link>http://www.nucleics.com/forum/read/10/831/2327.html#msg-2327</link>
      <author>Janelle</author>
      <description><![CDATA[Hi 

I current use and maintain an ABI3700. I'm sure I would have the software but Applied Biosystems no longer produce the polymer for the instrument. Does anyone know of an alternative to the Applied Biosystems polymer, POP-6?

Cheers]]></description>
      <category>DNA Sequencing Forum</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/10/831/2327.html#msg-2327</guid>
      <pubDate>Thu, 29 Jan 2009 00:18:33 -0500</pubDate>
    </item>
    <item>
      <title>misterious sequencing</title>
      <link>http://www.nucleics.com/forum/read/10/2293/2293.html#msg-2293</link>
      <author>Daniel Xi</author>
      <description><![CDATA[I have the following DNA sequence which gives perfect forward result but the reverse is messy. PCR product is a sharp single band. Either  gel purification or SAP-IT is used before sequencing reaction. Can someone here point out the key? Thanks.

TTATNNGAATATCTATATAATTGATACATATTTTAATTATAAAAACTTAAGTAGTATTAAATATTGATATTTCTTTTTGTACAAACCTTTGTTAGTAATTTTAGTTCATATTCAGTTATACATTGTTTTT
GGATGTTTATGCAATCTTATTTAAATATTTTAAAAATAATTGTAATATACTATTTTGAGCACATTTTTGTGTCTCATTTA
CTTTATTCATTTATCATTGTTATCGTCCTTAGGAAAACGTTATTTTCCTTATTTGGAAAATGGACATAATGAAAATTACG
GAAGAAAGTTTGTACAGGGTAACTCTGTAGAAGTTGCCTTCCTTCCTGGCTGTGGTCTTCCAAATGAGCAGACCACAGTT
ACATGTATGGAGAATGGCTGGTCTCCTCCTTGCAGATGCATCCGTGTCACTA]]></description>
      <category>DNA Sequencing Forum</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/10/2293/2293.html#msg-2293</guid>
      <pubDate>Wed, 14 Jan 2009 16:36:45 -0500</pubDate>
    </item>
    <item>
      <title>Re: short sequences problem</title>
      <link>http://www.nucleics.com/forum/read/10/2060/2078.html#msg-2078</link>
      <author>nucleics</author>
      <description><![CDATA[I now just have to find where I saved the document :)]]></description>
      <category>DNA Sequencing Forum</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/10/2060/2078.html#msg-2078</guid>
      <pubDate>Wed, 03 Dec 2008 16:57:42 -0500</pubDate>
    </item>
    <item>
      <title>Re: problem in sequencing with one primer</title>
      <link>http://www.nucleics.com/forum/read/10/1199/2074.html#msg-2074</link>
      <author>FunctionalBio</author>
      <description><![CDATA[Hi,

I work for a sequencing service called Functional Biosciences, Inc so i have alot of experience with these types of problems.

If you're doing some chromasomal DNA, its possible you have a heterozygous insertion/deletion mutation.  If its an in/del you might be able to see a pattern where one of the chromasome's sequence is shifted a few bases to the left or right. The two chromasome's being different causes two sets of peaks, each half the height of a normal peak.

Does the forward primer reach all the way across to this specific point in the sequence?  If the forward is able to go past this sequence without any changes, then its probably not an in/del.]]></description>
      <category>DNA Sequencing Forum</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/10/1199/2074.html#msg-2074</guid>
      <pubDate>Wed, 03 Dec 2008 09:02:38 -0500</pubDate>
    </item>
  </channel>
</rss>
