<?xml version="1.0" encoding="iso-8859-1" ?>
<rss version="2.0">
  <channel>
    <title>PCR Forum</title>
    <link>http://www.nucleics.com/forum/list/12.html</link>
    <description><![CDATA[Help for PCR problems or optimisation]]></description>
    <language>EN</language>
    <pubDate>Wed, 15 Aug 2012 06:16:00 +1000</pubDate>
    <lastBuildDate>Wed, 15 Aug 2012 06:16:00 +1000</lastBuildDate>
    <category>PCR Forum</category>
    <generator>Phorum 5.1.22</generator>
    <ttl>600</ttl>
    <item>
      <title>same primers, different products in PCR and qPCR</title>
      <link>http://www.nucleics.com/forum/read/12/4414/4414.html#msg-4414</link>
      <author>alqga</author>
      <description><![CDATA[Hello,

I am new here and I don´t know if this question has already been answered but here it goes. 

I have run a qPCR with new primers and I got amplification and nice melting curves. IN addition I loaded an agarose gel and the product had the expected size (around 180 bp)

 However, I wanted to sequence the product to be sure and when I run the conventional PCR  prior to the purification of the DNA and I loaded a gel to see the size of the product I obtain a huuuge product (1000 bp) what has nothing to do with the product I got in the qPCR

Any hint about what can be?? (sorry if this is too basic but I´m quite new...)

Thanks!]]></description>
      <category>PCR Forum</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/12/4414/4414.html#msg-4414</guid>
      <pubDate>Wed, 15 Aug 2012 06:16:00 +1000</pubDate>
    </item>
    <item>
      <title>nematode gut amplification</title>
      <link>http://www.nucleics.com/forum/read/12/4393/4393.html#msg-4393</link>
      <author>storytime</author>
      <description><![CDATA[Hello,

I have been working on amplifying bacteria from the guts of c.elegans.

My protocol is as follows:

- extract gut from nematode (yes the gut is less than a 1 mm wide and about 3-5 mm long)
- freeze for 10 mins (at -80) to lyse the cells
- run a 5% prot k treatment
- add reagents for PCR as follows:

2.5-2.9 uL of MgCl2
3 uL of Hot Start Buffer
3 uL of each primer (forward and reverse, im using 1492R and 27F)
1 uL of dntps at 6 uM conecntration
14.44-14.04 uL of H2O (altered based on mgcl2 amount)
2.5 uL (approx) of DNA sample

30 uL total volume

using an annealing temp of 54 C and running a standard protocol with 35 cycles. also added an extra 5min at 95 C, at the start before the loop. [even added extra 30 seconds (1.5 min total) to extension cycle but still didnt work]

My problem is that I get NO amplification. The positive control shows up (using extracted genomic DNA from streak) but I see no bands for my samples. Occasionally I see one or two (out of 5) but it is extremely inconsistent.

I have tried running a MgCl2 gradient (2.5, 2.7, 2.9, 3.1 etc...) to no avail.

I've heard that my sample could be amplifying but that its still two low to see a band. I've quantified the product via Qubit and they are substantially (10 fold) more concentrated than my -control (all reagents but no template). For some reason however doing a nested PCR doesn't seem to produce results.

I have tried to proceed with the spotty results that I get (TOPO cloning vector) but unfortunately there seemed to be no insert in the vectors after amplifying 20-30 different colonies and attempting the whole cloning a second time.

The price of the cloning is far to expensive for me to keep attempting and I was hoping that at some point I would get my guts to amplify at least 80% of the time.

Anybody have any suggestions as to what I might to do improve the amplification and/or verify that I actually have product even if the bands are not showing up.

I have been working on this for almost a year and it is very discouraging. Please help :(]]></description>
      <category>PCR Forum</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/12/4393/4393.html#msg-4393</guid>
      <pubDate>Tue, 01 Nov 2011 16:55:36 +1100</pubDate>
    </item>
    <item>
      <title>PAPD PCR</title>
      <link>http://www.nucleics.com/forum/read/12/4392/4392.html#msg-4392</link>
      <author>Hano</author>
      <description><![CDATA[I need to know about RAPD PCR, please guide me how can I get good practical information about this subject to start my project]]></description>
      <category>PCR Forum</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/12/4392/4392.html#msg-4392</guid>
      <pubDate>Sat, 08 Oct 2011 06:15:39 +1100</pubDate>
    </item>
    <item>
      <title>poly AAAAAAAA at both ends?</title>
      <link>http://www.nucleics.com/forum/read/12/4391/4391.html#msg-4391</link>
      <author>addishah</author>
      <description><![CDATA[So folks,

I repeatedly face a problem recently where sequences I get back from the sequencer appear to have long stretches of poly A at both ends, meaning that I can't get sequence with either M13 forward or M13 reverse sequencing primer. I don't think I want the sequence of these anyway, but my point is- what causes this kind of product to be produced and how can avoid it being produced in future?]]></description>
      <category>PCR Forum</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/12/4391/4391.html#msg-4391</guid>
      <pubDate>Mon, 04 Jul 2011 14:37:20 +1000</pubDate>
    </item>
    <item>
      <title>Re: PCR trascendental questions</title>
      <link>http://www.nucleics.com/forum/read/12/4385/4387.html#msg-4387</link>
      <author>nucleics</author>
      <description><![CDATA[Firstly, Taq is not unstable at room temperature. 

Secondly, I am not sure where you got this 1:100 template to primer ratio from but this is also wrong. I guess if you your assumptions are wrong then you should not be surprised when the results don't make much sense :)

Daniel]]></description>
      <category>PCR Forum</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/12/4385/4387.html#msg-4387</guid>
      <pubDate>Mon, 09 May 2011 18:07:15 +1000</pubDate>
    </item>
    <item>
      <title>PCR trascendental questions</title>
      <link>http://www.nucleics.com/forum/read/12/4385/4385.html#msg-4385</link>
      <author>dalpa8</author>
      <description><![CDATA[I'm relatively a newbie in PCR but I'm trying to find out some info and didn't get it. 
I have these 2 concerns: 

1) why is Taq polymerase so unstable at room temperature but stable at 95C? 


2) All the PCR protocols I found mostly have a ratio of template/primers around 1:100. This is the problem I see: every cycle we do, we are consuming primers at the same rate of PCR products are formed. Basic maths showed that by cycle 6-7 (around 128 PCR products) all of our primers should have been used and therefore the PCR reaction shouldn't go on. 
I feel that I'm missing something important because all that I found repeat the 1:100 template/primer ratio. 
I'll appreciate your help!
Thank you,
David]]></description>
      <category>PCR Forum</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/12/4385/4385.html#msg-4385</guid>
      <pubDate>Sat, 07 May 2011 03:11:20 +1000</pubDate>
    </item>
    <item>
      <title>Re: PCR  Tell me the particular annealing temp for these primer</title>
      <link>http://www.nucleics.com/forum/read/12/102/4260.html#msg-4260</link>
      <author>elizabeth</author>
      <description><![CDATA[I have 32 isolates from soil . I have also extracted the DNA and doing the 16S rDNA pcr amplification. But for one group of isolates I am the primer I used has annealing temperature 58 as compare to another group of isolates which is 63 for the same primer.]]></description>
      <category>PCR Forum</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/12/102/4260.html#msg-4260</guid>
      <pubDate>Tue, 05 Apr 2011 20:08:50 +1000</pubDate>
    </item>
    <item>
      <title>Re: No amplification - Taqman</title>
      <link>http://www.nucleics.com/forum/read/12/4249/4250.html#msg-4250</link>
      <author>nucleics</author>
      <description><![CDATA[Do you have a positive control for the reverse transcription step? Do you have another PCR primer set that you can use on the cDNA (a house keeping gene) that you can use to check that cDNA is OK. Have you tried spiking in DNA to make sure there are no inhibitors present?]]></description>
      <category>PCR Forum</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/12/4249/4250.html#msg-4250</guid>
      <pubDate>Fri, 25 Mar 2011 07:47:33 +1100</pubDate>
    </item>
    <item>
      <title>No amplification - Taqman</title>
      <link>http://www.nucleics.com/forum/read/12/4249/4249.html#msg-4249</link>
      <author>C. Sipert</author>
      <description><![CDATA[I performed the RNA isolation from cell lisate in Trizol with a spin column kit. Prior to RNA isolation, the samples were stored at -80oC. Reading at Nanodrop is ok. RNA gels show both RNA bands. However, after performing the reverse transcription (Qiagen kit), we are not able to obtain any amplification of RPL13 gene throught qPCR using Taqman Mix (Applied Biosystems). The primers and probe are ok. We just can't figure out the possible existing problems.]]></description>
      <category>PCR Forum</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/12/4249/4249.html#msg-4249</guid>
      <pubDate>Fri, 25 Mar 2011 06:48:14 +1100</pubDate>
    </item>
    <item>
      <title>Re: PCR product storage</title>
      <link>http://www.nucleics.com/forum/read/12/409/4244.html#msg-4244</link>
      <author>Rizi</author>
      <description><![CDATA[hi
my issue is also related to PCR storage product, the problem is that I am doing my PCRs and finnlizing before purification and sequencing, and have to send the sample after PCR (without any purification) to the lab for purification as well sequencing (as v hav't both of these right now in our lab), thus please tell how long I could store my PCRs product and at what temperature??and at what way best to send the samples safely to outside country...



anxiously waiting for kind response]]></description>
      <category>PCR Forum</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/12/409/4244.html#msg-4244</guid>
      <pubDate>Sun, 20 Mar 2011 17:07:34 +1100</pubDate>
    </item>
    <item>
      <title>Can two antisense primers work together</title>
      <link>http://www.nucleics.com/forum/read/12/4207/4207.html#msg-4207</link>
      <author>Adel</author>
      <description><![CDATA[I received a protocol of PCR for KO mice. In the protocol, they use sense primer (CGGTCAACAAACCTACTCAGAATCAGG) and antisense primer (CTGAACTCACATGGAGGCAGGATATAA) for WT identification,and use the same antisense primer (CTGAACTCACATGGAGGCAGGATATAA) with another antisense primer (GAGCGCGCGCGGCGGAGTTGTTGAC) for KO identification. The PCR progress is not going well. Does it make sense to use two antisense primers together?If yes, how it does?
Thank you.]]></description>
      <category>PCR Forum</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/12/4207/4207.html#msg-4207</guid>
      <pubDate>Wed, 16 Feb 2011 07:51:02 +1100</pubDate>
    </item>
    <item>
      <title>Re: weird pcr product  ask for help!</title>
      <link>http://www.nucleics.com/forum/read/12/2871/4195.html#msg-4195</link>
      <author>Amanda</author>
      <description><![CDATA[It sounds like this could be a problem with your gel or how the gel was run. Did your standard run the length of the gel or did it stay near the well as well?]]></description>
      <category>PCR Forum</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/12/2871/4195.html#msg-4195</guid>
      <pubDate>Thu, 10 Feb 2011 04:52:29 +1100</pubDate>
    </item>
    <item>
      <title>Re: PCR product storage</title>
      <link>http://www.nucleics.com/forum/read/12/409/4188.html#msg-4188</link>
      <author>nucleics</author>
      <description><![CDATA[This is lab forklore, but I can say I have tested it myself and it true.]]></description>
      <category>PCR Forum</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/12/409/4188.html#msg-4188</guid>
      <pubDate>Mon, 31 Jan 2011 11:49:32 +1100</pubDate>
    </item>
    <item>
      <title>Re: PCR product storage</title>
      <link>http://www.nucleics.com/forum/read/12/409/4186.html#msg-4186</link>
      <author>Fernando</author>
      <description><![CDATA[Hi, Why the 3' overhangs tends to be removed after long time storage in the freezer? Someone have any paper that say that or is just popular culture? Thanks]]></description>
      <category>PCR Forum</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/12/409/4186.html#msg-4186</guid>
      <pubDate>Sat, 29 Jan 2011 11:08:51 +1100</pubDate>
    </item>
    <item>
      <title>Re: PCR product storage</title>
      <link>http://www.nucleics.com/forum/read/12/409/4032.html#msg-4032</link>
      <author>nucleics</author>
      <description><![CDATA[Hi Kate

In the fridge short term and in the freezer long term. It is not a good idea to store PCR products if you plan to TA clone - storage seems to remove the 3' A overhang.]]></description>
      <category>PCR Forum</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/12/409/4032.html#msg-4032</guid>
      <pubDate>Wed, 05 Jan 2011 11:30:27 +1100</pubDate>
    </item>
    <item>
      <title>Re: PCR product storage</title>
      <link>http://www.nucleics.com/forum/read/12/409/4031.html#msg-4031</link>
      <author>Kate</author>
      <description><![CDATA[Hey,
after PCR how can I storage product?]]></description>
      <category>PCR Forum</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/12/409/4031.html#msg-4031</guid>
      <pubDate>Wed, 05 Jan 2011 00:52:46 +1100</pubDate>
    </item>
    <item>
      <title>Re: PCR Hint #3 Tm is determined by the lowest primer</title>
      <link>http://www.nucleics.com/forum/read/12/102/3965.html#msg-3965</link>
      <author>Hang tran</author>
      <description><![CDATA[Please explain more clearly about Tm!]]></description>
      <category>PCR Forum</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/12/102/3965.html#msg-3965</guid>
      <pubDate>Thu, 09 Dec 2010 20:05:36 +1100</pubDate>
    </item>
    <item>
      <title>Re: melting temperature of the primers</title>
      <link>http://www.nucleics.com/forum/read/12/3931/3955.html#msg-3955</link>
      <author>nucleics</author>
      <description><![CDATA[If you want to make a 54 base oligo just contact a company that makes them and give them the sequence you want. They will make it and ship it to you.]]></description>
      <category>PCR Forum</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/12/3931/3955.html#msg-3955</guid>
      <pubDate>Wed, 24 Nov 2010 23:31:24 +1100</pubDate>
    </item>
    <item>
      <title>Re: melting temperature of the primers</title>
      <link>http://www.nucleics.com/forum/read/12/3931/3936.html#msg-3936</link>
      <author>lakshmi</author>
      <description><![CDATA[dear sir,

     thank you for the reply. i was advised to get my 54 bases as chemically synthesised oligonucleotides. but am not sure how this works. can u pls make tis clear?


regards,
 
lakshmi]]></description>
      <category>PCR Forum</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/12/3931/3936.html#msg-3936</guid>
      <pubDate>Wed, 17 Nov 2010 19:11:11 +1100</pubDate>
    </item>
    <item>
      <title>Re: melting temperature of the primers</title>
      <link>http://www.nucleics.com/forum/read/12/3931/3932.html#msg-3932</link>
      <author>nucleics</author>
      <description><![CDATA[The problem with using such low binding temperature primers is two fold. the first is Taq does not have much activity at 30C. The second is the template will have a fair amount of secondary structure that prevents the primer binding. The experiments we have done developing UniSeq showed that you really want to stay above 37C annealing temp and also have at least 11 bases binding.]]></description>
      <category>PCR Forum</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/12/3931/3932.html#msg-3932</guid>
      <pubDate>Wed, 17 Nov 2010 16:43:51 +1100</pubDate>
    </item>
    <item>
      <title>melting temperature of the primers</title>
      <link>http://www.nucleics.com/forum/read/12/3931/3931.html#msg-3931</link>
      <author>lakshmi</author>
      <description><![CDATA[hi all...

         i hv a small doubt with my pcr primers. i hv to amplify a fragment of 54 bp, for which i designed a set of 10 nucleotide primers. but the melting temperature of the primers is 30 degrees C. i hv a doubt if such a low melting temperature will interfere in the amplification. i also want to know if anyone has amplified a small fragment like tis. pls help with the preferrable extension time for the primers. kindly help.....

regards,
 
lakshmi]]></description>
      <category>PCR Forum</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/12/3931/3931.html#msg-3931</guid>
      <pubDate>Wed, 17 Nov 2010 16:07:04 +1100</pubDate>
    </item>
    <item>
      <title>Re: PCR product storage</title>
      <link>http://www.nucleics.com/forum/read/12/409/3885.html#msg-3885</link>
      <author>suby</author>
      <description><![CDATA[Hi, I have the same question.]]></description>
      <category>PCR Forum</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/12/409/3885.html#msg-3885</guid>
      <pubDate>Tue, 19 Oct 2010 22:27:28 +1100</pubDate>
    </item>
    <item>
      <title>Platinum Pfx Polymerase by Invitrogen</title>
      <link>http://www.nucleics.com/forum/read/12/3447/3447.html#msg-3447</link>
      <author>desireeazanes</author>
      <description><![CDATA[I am doing some cloning work so I used Platinum Pfx Polymerase for my PCR.  I also used two sets of primers.  The results were great for the second primer set but not with the first primer set. I tried including varying amounts of PCR enhancer that comes with the kit but again, no product.  

Has anyone used this product before?

Please suggest what I can do to optimize the conditions.

Thanks!]]></description>
      <category>PCR Forum</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/12/3447/3447.html#msg-3447</guid>
      <pubDate>Thu, 13 May 2010 13:46:24 +1000</pubDate>
    </item>
    <item>
      <title>Re: PCR product storage</title>
      <link>http://www.nucleics.com/forum/read/12/409/3076.html#msg-3076</link>
      <author>Mark Flinn</author>
      <description><![CDATA[After having mixed together the master mix along with primers, templates, et cetera, how long (and how) can I store the tubes BEFORE running PCR?]]></description>
      <category>PCR Forum</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/12/409/3076.html#msg-3076</guid>
      <pubDate>Tue, 20 Apr 2010 12:17:46 +1000</pubDate>
    </item>
    <item>
      <title>SSP=PCR</title>
      <link>http://www.nucleics.com/forum/read/12/3062/3062.html#msg-3062</link>
      <author>cyang</author>
      <description><![CDATA[What is sequence specific primer and single specific primer?
I would like to know what do the sequence specific primer and the  single specific primer same ?]]></description>
      <category>PCR Forum</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/12/3062/3062.html#msg-3062</guid>
      <pubDate>Wed, 31 Mar 2010 13:24:39 +1100</pubDate>
    </item>
    <item>
      <title>Failure to sequence DNA from amniotic fluid</title>
      <link>http://www.nucleics.com/forum/read/12/2947/2947.html#msg-2947</link>
      <author>Nethra</author>
      <description><![CDATA[Hi im a molecular biologist working at a genetic diagnostic laboratory and am currently facing a problem with sequencing DNA from amniotic fluid samples for diagnosis of ß-thalassemia. We use and ABI 3130 sequencing machine and have the usual protocol of PCR, purification and cycle sequencing. Since of late we are unable to get any product from DNA extracted from amniotic fluid. We have ruled out possibility of Primer and PCR cycle problems and DNA from blood gives a clear cut result. I value any suggestions or advice anyone has to offer and asap please. If a similar work is going on I would also appreciate any references that will help. Thanks]]></description>
      <category>PCR Forum</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/12/2947/2947.html#msg-2947</guid>
      <pubDate>Wed, 03 Mar 2010 03:57:17 +1100</pubDate>
    </item>
    <item>
      <title>weird pcr product  ask for help!</title>
      <link>http://www.nucleics.com/forum/read/12/2871/2871.html#msg-2871</link>
      <author>nccutudou</author>
      <description><![CDATA[I did three batches of pcr last Monday and Tuesday. Got bands every time. Weird things happened when I tried a large batch of samples last Thursday. Target bands did not show in gel. But you could see that pcr products showed near gel wells. I tried new tubes of buffers,dntps,primers and taq for three times and it didn't work. I even tried the exactly same templates which got bands before. The result were still same. No bands at all. What could be the reason? Thanks
I'm new here. I don't know how to post picture here? I think the picutres of gel may help to know the problems better.]]></description>
      <category>PCR Forum</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/12/2871/2871.html#msg-2871</guid>
      <pubDate>Mon, 18 Jan 2010 04:47:26 +1100</pubDate>
    </item>
    <item>
      <title>Re: PCR product storage</title>
      <link>http://www.nucleics.com/forum/read/12/409/2865.html#msg-2865</link>
      <author>suranjana</author>
      <description><![CDATA[Jinous Wrote:
-------------------------------------------------------
&gt; How long we can keep our PCR products(if they are
&gt; in water) in the fridge before purificatin
&gt; procedue and how long before cloning? Don't
&gt; freezing and thawing influence our tests? Do you
&gt; recommend us to freeze all of our samples in water
&gt; after PCR,if we don't have time to continue the
&gt; procedure immediately?
My refrigerator (-20 c) was switched off for overnight and my PCR products were there. Is it o.k ?]]></description>
      <category>PCR Forum</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/12/409/2865.html#msg-2865</guid>
      <pubDate>Mon, 11 Jan 2010 19:36:40 +1100</pubDate>
    </item>
    <item>
      <title>Rapid Amplification of cDNA Ends question</title>
      <link>http://www.nucleics.com/forum/read/12/2853/2853.html#msg-2853</link>
      <author>hianghao</author>
      <description><![CDATA[Hi, i am new in molecular biology and i need some help in RACE...
In 5' RACE, after the production of 1st strand cDNA using gene-specific-primer 1 and addition of polyT tail, another gsp 2 is used together with anchor primer to amplify that cDNA. My question is, why don't we use gsp1 for amplification instead of gsp2?
2nd is, if gsp1 &amp; 2 are parts of known sequence (designated as X) which i obtain from 3'RACE, will X have overlapping sequence with cDNA obtain from 5'RACE? If yes, can i assume that the overlapping sequence is the sequence of gsp2+a few nucleotide, since i get gsp1 from X?
3rd, can i directly use cDNA generated from 3'RACE as primer for 5'RACE, instead of using some part of it to design gsp1? If not, y?]]></description>
      <category>PCR Forum</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/12/2853/2853.html#msg-2853</guid>
      <pubDate>Tue, 05 Jan 2010 11:33:47 +1100</pubDate>
    </item>
    <item>
      <title>PCR primer concentration- pls read this n pls reply!!</title>
      <link>http://www.nucleics.com/forum/read/12/2841/2841.html#msg-2841</link>
      <author>DK</author>
      <description><![CDATA[I'm working with DNA aptamers and i cannot figure out how to set up my PCR. My oligos are around 100 bases in length and i need to perform a PCR after each Selex round.. the general PCR setup suggests a primer concentration of 1uM..that wud be around 100pmoles of primer in a 100ul reaction rite??So if i wanted to amplify my oligos..for say 10 rounds.. how do i calculate the amount of template i start with? The way i figure...with a lot of calculation.. is that i cannot even amplify..say 1 pmol of my oligos?? Is there an easier way to calculate the template vs primer ratio? Keeping in mind the size of my oligos?]]></description>
      <category>PCR Forum</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/12/2841/2841.html#msg-2841</guid>
      <pubDate>Thu, 24 Dec 2009 14:30:00 +1100</pubDate>
    </item>
  </channel>
</rss>
