<?xml version="1.0" encoding="iso-8859-1" ?>
<rss version="2.0">
  <channel>
    <title>PCR Forum</title>
    <link>http://www.nucleics.com/forum/list/12.html</link>
    <description><![CDATA[Help for PCR problems or optimisation]]></description>
    <language>EN</language>
    <pubDate>Wed, 12 May 2010 23:46:24 -0400</pubDate>
    <lastBuildDate>Wed, 12 May 2010 23:46:24 -0400</lastBuildDate>
    <category>PCR Forum</category>
    <generator>Phorum 5.1.22</generator>
    <ttl>600</ttl>
    <item>
      <title>Platinum Pfx Polymerase by Invitrogen</title>
      <link>http://www.nucleics.com/forum/read/12/3447/3447.html#msg-3447</link>
      <author>desireeazanes</author>
      <description><![CDATA[I am doing some cloning work so I used Platinum Pfx Polymerase for my PCR.  I also used two sets of primers.  The results were great for the second primer set but not with the first primer set. I tried including varying amounts of PCR enhancer that comes with the kit but again, no product.  

Has anyone used this product before?

Please suggest what I can do to optimize the conditions.

Thanks!]]></description>
      <category>PCR Forum</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/12/3447/3447.html#msg-3447</guid>
      <pubDate>Wed, 12 May 2010 23:46:24 -0400</pubDate>
    </item>
    <item>
      <title>Re: PCR product storage</title>
      <link>http://www.nucleics.com/forum/read/12/409/3076.html#msg-3076</link>
      <author>Mark Flinn</author>
      <description><![CDATA[After having mixed together the master mix along with primers, templates, et cetera, how long (and how) can I store the tubes BEFORE running PCR?]]></description>
      <category>PCR Forum</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/12/409/3076.html#msg-3076</guid>
      <pubDate>Mon, 19 Apr 2010 22:17:46 -0400</pubDate>
    </item>
    <item>
      <title>SSP=PCR</title>
      <link>http://www.nucleics.com/forum/read/12/3062/3062.html#msg-3062</link>
      <author>cyang</author>
      <description><![CDATA[What is sequence specific primer and single specific primer?
I would like to know what do the sequence specific primer and the  single specific primer same ?]]></description>
      <category>PCR Forum</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/12/3062/3062.html#msg-3062</guid>
      <pubDate>Tue, 30 Mar 2010 22:24:39 -0400</pubDate>
    </item>
    <item>
      <title>Failure to sequence DNA from amniotic fluid</title>
      <link>http://www.nucleics.com/forum/read/12/2947/2947.html#msg-2947</link>
      <author>Nethra</author>
      <description><![CDATA[Hi im a molecular biologist working at a genetic diagnostic laboratory and am currently facing a problem with sequencing DNA from amniotic fluid samples for diagnosis of ß-thalassemia. We use and ABI 3130 sequencing machine and have the usual protocol of PCR, purification and cycle sequencing. Since of late we are unable to get any product from DNA extracted from amniotic fluid. We have ruled out possibility of Primer and PCR cycle problems and DNA from blood gives a clear cut result. I value any suggestions or advice anyone has to offer and asap please. If a similar work is going on I would also appreciate any references that will help. Thanks]]></description>
      <category>PCR Forum</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/12/2947/2947.html#msg-2947</guid>
      <pubDate>Tue, 02 Mar 2010 11:57:17 -0500</pubDate>
    </item>
    <item>
      <title>weird pcr product  ask for help!</title>
      <link>http://www.nucleics.com/forum/read/12/2871/2871.html#msg-2871</link>
      <author>nccutudou</author>
      <description><![CDATA[I did three batches of pcr last Monday and Tuesday. Got bands every time. Weird things happened when I tried a large batch of samples last Thursday. Target bands did not show in gel. But you could see that pcr products showed near gel wells. I tried new tubes of buffers,dntps,primers and taq for three times and it didn't work. I even tried the exactly same templates which got bands before. The result were still same. No bands at all. What could be the reason? Thanks
I'm new here. I don't know how to post picture here? I think the picutres of gel may help to know the problems better.]]></description>
      <category>PCR Forum</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/12/2871/2871.html#msg-2871</guid>
      <pubDate>Sun, 17 Jan 2010 12:47:26 -0500</pubDate>
    </item>
    <item>
      <title>Re: PCR product storage</title>
      <link>http://www.nucleics.com/forum/read/12/409/2865.html#msg-2865</link>
      <author>suranjana</author>
      <description><![CDATA[Jinous Wrote:
-------------------------------------------------------
&gt; How long we can keep our PCR products(if they are
&gt; in water) in the fridge before purificatin
&gt; procedue and how long before cloning? Don't
&gt; freezing and thawing influence our tests? Do you
&gt; recommend us to freeze all of our samples in water
&gt; after PCR,if we don't have time to continue the
&gt; procedure immediately?
My refrigerator (-20 c) was switched off for overnight and my PCR products were there. Is it o.k ?]]></description>
      <category>PCR Forum</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/12/409/2865.html#msg-2865</guid>
      <pubDate>Mon, 11 Jan 2010 03:36:40 -0500</pubDate>
    </item>
    <item>
      <title>Rapid Amplification of cDNA Ends question</title>
      <link>http://www.nucleics.com/forum/read/12/2853/2853.html#msg-2853</link>
      <author>hianghao</author>
      <description><![CDATA[Hi, i am new in molecular biology and i need some help in RACE...
In 5' RACE, after the production of 1st strand cDNA using gene-specific-primer 1 and addition of polyT tail, another gsp 2 is used together with anchor primer to amplify that cDNA. My question is, why don't we use gsp1 for amplification instead of gsp2?
2nd is, if gsp1 &amp; 2 are parts of known sequence (designated as X) which i obtain from 3'RACE, will X have overlapping sequence with cDNA obtain from 5'RACE? If yes, can i assume that the overlapping sequence is the sequence of gsp2+a few nucleotide, since i get gsp1 from X?
3rd, can i directly use cDNA generated from 3'RACE as primer for 5'RACE, instead of using some part of it to design gsp1? If not, y?]]></description>
      <category>PCR Forum</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/12/2853/2853.html#msg-2853</guid>
      <pubDate>Mon, 04 Jan 2010 19:33:47 -0500</pubDate>
    </item>
    <item>
      <title>PCR primer concentration- pls read this n pls reply!!</title>
      <link>http://www.nucleics.com/forum/read/12/2841/2841.html#msg-2841</link>
      <author>DK</author>
      <description><![CDATA[I'm working with DNA aptamers and i cannot figure out how to set up my PCR. My oligos are around 100 bases in length and i need to perform a PCR after each Selex round.. the general PCR setup suggests a primer concentration of 1uM..that wud be around 100pmoles of primer in a 100ul reaction rite??So if i wanted to amplify my oligos..for say 10 rounds.. how do i calculate the amount of template i start with? The way i figure...with a lot of calculation.. is that i cannot even amplify..say 1 pmol of my oligos?? Is there an easier way to calculate the template vs primer ratio? Keeping in mind the size of my oligos?]]></description>
      <category>PCR Forum</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/12/2841/2841.html#msg-2841</guid>
      <pubDate>Wed, 23 Dec 2009 22:30:00 -0500</pubDate>
    </item>
    <item>
      <title>Thermal Detector for PCR machines</title>
      <link>http://www.nucleics.com/forum/read/12/2828/2828.html#msg-2828</link>
      <author>MMM</author>
      <description><![CDATA[Does anybody know anything that can be used for measuring the temperatures in the wells of PCR machines during thermal cycles?

Thanks in advance!]]></description>
      <category>PCR Forum</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/12/2828/2828.html#msg-2828</guid>
      <pubDate>Wed, 16 Dec 2009 17:49:45 -0500</pubDate>
    </item>
    <item>
      <title>Re: RE failure</title>
      <link>http://www.nucleics.com/forum/read/12/2734/2822.html#msg-2822</link>
      <author>nucleics</author>
      <description><![CDATA[Yes it might be methylation that is the cause. Unless there is another enzyme that is not affected by methylation that you can use you won't be much you can do about this. Might be worth trying another enzyme site.]]></description>
      <category>PCR Forum</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/12/2734/2822.html#msg-2822</guid>
      <pubDate>Mon, 14 Dec 2009 17:26:01 -0500</pubDate>
    </item>
    <item>
      <title>Re: PCR product storage</title>
      <link>http://www.nucleics.com/forum/read/12/409/2821.html#msg-2821</link>
      <author>nucleics</author>
      <description><![CDATA[The problem with storing PCR products in water is if you have any nucleases around. It is better to store them in 10/0.1 TE. This way the pH won't drop from absorbance of CO2 and the EDTA will keep the nucleases from chewing up the DNA.]]></description>
      <category>PCR Forum</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/12/409/2821.html#msg-2821</guid>
      <pubDate>Mon, 14 Dec 2009 17:23:51 -0500</pubDate>
    </item>
    <item>
      <title>Re: Primers out overnight</title>
      <link>http://www.nucleics.com/forum/read/12/2738/2820.html#msg-2820</link>
      <author>nucleics</author>
      <description><![CDATA[Most likely yes, especially if you store them in 10/0.1 TE.]]></description>
      <category>PCR Forum</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/12/2738/2820.html#msg-2820</guid>
      <pubDate>Mon, 14 Dec 2009 17:21:53 -0500</pubDate>
    </item>
    <item>
      <title>Re: one day pcr works, the next it doesn't</title>
      <link>http://www.nucleics.com/forum/read/12/2782/2806.html#msg-2806</link>
      <author>nucleics</author>
      <description><![CDATA[This sounds like primer poisoning. What happens is you end up contaminating your work area with primer dimers and small fragments from your PCR and they kill the later PCR reactions. This is arely problem with long PCR. The solution is to make all new solutions and use different pippetors (go to a different lab to set up the reaction).]]></description>
      <category>PCR Forum</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/12/2782/2806.html#msg-2806</guid>
      <pubDate>Thu, 03 Dec 2009 00:53:31 -0500</pubDate>
    </item>
    <item>
      <title>ETS amplification problem</title>
      <link>http://www.nucleics.com/forum/read/12/2804/2804.html#msg-2804</link>
      <author>Simon Uribe</author>
      <description><![CDATA[Hi all, 
I've been having problems amplifying ETS from plant samples. I've been getting a band in my negatives and this band has been around in my lab for some time now. Some people have sequenced it without getting any results (i.e. nothing, being a dye blob or something) but then i sequenced it and I got a full 400bp sequence! 
Now everybody is freaking out and we can't get rid off it. I've tried UVing the stock primer, change set of primers (ETS B - 18sIGS  to ETS B - 18sE) reduce amount of primer in master mix to half, amplifying without BSA, and changing annealing temperature. I was wondering if anyone has had this problem too. 
Thanks a lot 

Simon]]></description>
      <category>PCR Forum</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/12/2804/2804.html#msg-2804</guid>
      <pubDate>Thu, 03 Dec 2009 00:47:44 -0500</pubDate>
    </item>
    <item>
      <title>one day pcr works, the next it doesn't</title>
      <link>http://www.nucleics.com/forum/read/12/2782/2782.html#msg-2782</link>
      <author>Paul</author>
      <description><![CDATA[Hello,

I'm having a problem with a long range PCR. When I received my primers I tested them out, using a small volume of aliquotted and diluted primers, on a gradient to dial in Tm. They worked beautifully. After a couple days I then did my experiment (with a new aliquot of primers which I'll call my working primers) and now no bands, just large dark streaks up near the wells (I'm assuming it's due to secondary structure). I figure I made a mistake aliquotting my working primers so I re-ran the PCR, this time with the original test primers (as a positive control), plus my working primers, plus a newly made aliquot from the stock plates. This time the test primers (positive control) did not work as well as before. The working primers made another smudge, and my new aliquot from stock also made a smudge. What could have happened to these in 2 days time that they would work beautifully then not work at all?

Thanks for any suggestions,
Paul]]></description>
      <category>PCR Forum</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/12/2782/2782.html#msg-2782</guid>
      <pubDate>Wed, 04 Nov 2009 16:27:09 -0500</pubDate>
    </item>
    <item>
      <title>Primers out overnight</title>
      <link>http://www.nucleics.com/forum/read/12/2738/2738.html#msg-2738</link>
      <author>Paula</author>
      <description><![CDATA[I accidently left my primers out at room temperature overnight. Are they still ok?]]></description>
      <category>PCR Forum</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/12/2738/2738.html#msg-2738</guid>
      <pubDate>Fri, 30 Oct 2009 17:25:05 -0400</pubDate>
    </item>
    <item>
      <title>RE failure</title>
      <link>http://www.nucleics.com/forum/read/12/2734/2734.html#msg-2734</link>
      <author>Les Alberque</author>
      <description><![CDATA[We are running Southern blots examining a DNA fragment of interest. We know the restriction sites and are using the appropriate RE's at the correct concentrations.

However, one RE site that we know exists persistently fails to be cut with the RE's.
This might suggest incomplete digestion?, methylation?, etc.

Has anyone encountered this problem? If so, do they have a solution?

Thanks,
Les]]></description>
      <category>PCR Forum</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/12/2734/2734.html#msg-2734</guid>
      <pubDate>Fri, 23 Oct 2009 13:56:36 -0400</pubDate>
    </item>
    <item>
      <title>Re: PCR product storage</title>
      <link>http://www.nucleics.com/forum/read/12/409/2725.html#msg-2725</link>
      <author>Jinous</author>
      <description><![CDATA[How long we can keep our PCR products(if they are in water) in the fridge before purificatin procedue and how long before cloning? Don't freezing and thawing influence our tests? Do you recommend us to freeze all of our samples in water after PCR,if we don't have time to continue the procedure immediately?]]></description>
      <category>PCR Forum</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/12/409/2725.html#msg-2725</guid>
      <pubDate>Wed, 30 Sep 2009 01:22:59 -0400</pubDate>
    </item>
    <item>
      <title>Smearing in PCR</title>
      <link>http://www.nucleics.com/forum/read/12/2721/2721.html#msg-2721</link>
      <author>meenal</author>
      <description><![CDATA[I am using FFPE extracted DNA for analyzing patients with EGFR mutation analysis. In EGFR, I am amplifying 3 exons, exon 18,19 and 21. I am able to amplify exon 19 and 21 but am not able to amplify exon 18. I am facing this problem since last 8 samples I am handling
before that it was working fine. I am using nested PCR approach for amplifying both exon 18 and exon 19. In Exon 18 PCR , I am getting
smearing and shorter non specific bands instead of a clear band.The
PCR protocol that I am using is as follows- 1X Std Taq buffer, 0.2uM
each primer, 200uM dNTP mix and 2U Taq DNA polymerase and cycling
conditions are 5 min at 95°C, 35 cycles of (95°C for 30sec, 57°C for
30sec, and 72°C for 45sec) and final extension at 72°C for 5min. PCR
product size is 400bp with outer set of primers and 380bp with inner
set of primers.

The older FFPE extracted DNA samples are still working with these set
of reagents and under the same PCR conditions mentioned above.

I have tried with all new set of reagents, new primer sets. I have
tried this PCR multiple times by changing Tm,adding DMSO, diluting the
DNA sample, changing primer concentration, dNTP concentration, and
also by changing the MgCl2 concentration in the increments of 0.5
(2mM, 2.5mM, 3mM, 3.5mM, 4mM). I would like to know what could be
causing problem in amplification.


Tags:]]></description>
      <category>PCR Forum</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/12/2721/2721.html#msg-2721</guid>
      <pubDate>Thu, 24 Sep 2009 07:30:42 -0400</pubDate>
    </item>
    <item>
      <title>PCR  Tell me the particular annealing temp for these primer</title>
      <link>http://www.nucleics.com/forum/read/12/102/2716.html#msg-2716</link>
      <author>Rajendra</author>
      <description><![CDATA[FP- CATATG ATG AGTTCTGCG CTGCACCCCTCG
RP- GGATCCCCACGAGGTCGCTCCCGTCCGC]]></description>
      <category>PCR Forum</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/12/102/2716.html#msg-2716</guid>
      <pubDate>Sun, 13 Sep 2009 10:58:02 -0400</pubDate>
    </item>
    <item>
      <title>PCR product storage</title>
      <link>http://www.nucleics.com/forum/read/12/409/2711.html#msg-2711</link>
      <author>ruchi baghel</author>
      <description><![CDATA[Is it better to keep PCR product for long or we should keep them in peg purified form. How long can we keep our PCR products.]]></description>
      <category>PCR Forum</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/12/409/2711.html#msg-2711</guid>
      <pubDate>Thu, 10 Sep 2009 09:56:13 -0400</pubDate>
    </item>
    <item>
      <title>Re: PCR Hint #3 Tm is determined by the lowest primer</title>
      <link>http://www.nucleics.com/forum/read/12/102/2696.html#msg-2696</link>
      <author>nucleics</author>
      <description><![CDATA[A good temperature to start at would be 55C and try going up from there.]]></description>
      <category>PCR Forum</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/12/102/2696.html#msg-2696</guid>
      <pubDate>Tue, 08 Sep 2009 09:42:32 -0400</pubDate>
    </item>
    <item>
      <title>Re: Amplyfing Mitochondrial DNA Control Region</title>
      <link>http://www.nucleics.com/forum/read/12/2581/2695.html#msg-2695</link>
      <author>nucleics</author>
      <description><![CDATA[Try hot starting your PCR. This can either be done by using a hot start enzyme or by adding the taq separately after the PCR reaches 80C (best if this is done in a large volume like 5µl).

Also try adding 500mM betaine - in my experience betaine is the best additive to use.]]></description>
      <category>PCR Forum</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/12/2581/2695.html#msg-2695</guid>
      <pubDate>Tue, 08 Sep 2009 09:40:37 -0400</pubDate>
    </item>
    <item>
      <title>Re: PCR Numerical.. Pls HELP</title>
      <link>http://www.nucleics.com/forum/read/12/2504/2694.html#msg-2694</link>
      <author>nucleics</author>
      <description><![CDATA[This is a difficult question to answer as the amplification efficiency changes throught the whole PCR reaction. Assuming 100% efficiency the answer is 5 x 2^30. In practice, 5 x 1.8^30 is more reasonable.]]></description>
      <category>PCR Forum</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/12/2504/2694.html#msg-2694</guid>
      <pubDate>Tue, 08 Sep 2009 09:37:40 -0400</pubDate>
    </item>
    <item>
      <title>Re: Taq Dilution</title>
      <link>http://www.nucleics.com/forum/read/12/2671/2693.html#msg-2693</link>
      <author>nucleics</author>
      <description><![CDATA[Yes you can store Taq in PCR buffer for a short time. Don't add the dNTPs. It will last at least a week in the fridge like this.]]></description>
      <category>PCR Forum</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/12/2671/2693.html#msg-2693</guid>
      <pubDate>Tue, 08 Sep 2009 09:35:19 -0400</pubDate>
    </item>
    <item>
      <title>Taq Dilution</title>
      <link>http://www.nucleics.com/forum/read/12/2671/2671.html#msg-2671</link>
      <author>Bassaml7</author>
      <description><![CDATA[Hi,

I'd like to ask for instructions about Taq DNA polymerase dilution. To avoid pipetting errors I have to dilute Taq, which is supplied in a concentration of 5 units / microL, to a concentration of 0.5 units / microL . I just wonder if I can use PCR reaction buffer for the dilution process. I know Taq is supplied in a special buffer which contains Glycerol , surfactants , etc . and I would prefer to use a solution of similar composition for dilution but that needs to be purchased and there doesn't seem to be many suppliers for that anyway. So I wonder if I can make a 1:10 dilution using just the PCR buffer and store in aliquotes safely . I am highly concerned about storing Taq in just PCR buffer. I know I could just make a dilution, use the amount I need , then throw away the rest of the solution but I just can't afford that. I need to store the rest for future use. 

Thank you in advance.]]></description>
      <category>PCR Forum</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/12/2671/2671.html#msg-2671</guid>
      <pubDate>Wed, 02 Sep 2009 13:07:25 -0400</pubDate>
    </item>
    <item>
      <title>Amplyfing Mitochondrial DNA Control Region</title>
      <link>http://www.nucleics.com/forum/read/12/2581/2581.html#msg-2581</link>
      <author>Daniel Acosta</author>
      <description><![CDATA[I have been having trouble amplifying the control region of two species.  In one (a parrot) the primers are universal, in the other (a felid;black-footed cat) the primers were designed for the closely related domestic cat. In both I have experienced non-specific binding. I have gone through the process of optimization, changing Ta and [Mg] and even template concentration.  Anyone have any ideas, or have had the same issues.  Thank you.]]></description>
      <category>PCR Forum</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/12/2581/2581.html#msg-2581</guid>
      <pubDate>Thu, 02 Jul 2009 19:14:00 -0400</pubDate>
    </item>
    <item>
      <title>PCR Numerical.. Pls HELP</title>
      <link>http://www.nucleics.com/forum/read/12/2504/2504.html#msg-2504</link>
      <author>Nimit</author>
      <description><![CDATA[5 picomole of primer and 5 copy of a gene = given

you have 100% PCR efficiency. What is the maximum molecule
that can accumulate in 30 cycles of PCR..?]]></description>
      <category>PCR Forum</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/12/2504/2504.html#msg-2504</guid>
      <pubDate>Mon, 11 May 2009 09:27:33 -0400</pubDate>
    </item>
    <item>
      <title>Re: p16 PCR</title>
      <link>http://www.nucleics.com/forum/read/12/2492/2502.html#msg-2502</link>
      <author>Chris</author>
      <description><![CDATA[Hi Daniel, 

That sounds like excellent news. Performing RT-PCR is my ultimate goal, I have access to an applied biosystems stepone plus light cycler where i hope to eventually use a sybr green dye to look at p16 mRNA. However I'm stuck at getting the the whole thing to work reliably at the moment. 

I have attempted performing what i mentioned, but because I was unsure if using simply a neat sample would work I also created dilutions of 10, 100, 200, 1000 and 2000. 

Will get let you know if it has worked! 

Thanks

Chris]]></description>
      <category>PCR Forum</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/12/2492/2502.html#msg-2502</guid>
      <pubDate>Fri, 08 May 2009 07:00:49 -0400</pubDate>
    </item>
    <item>
      <title>Re: p16 PCR</title>
      <link>http://www.nucleics.com/forum/read/12/2492/2501.html#msg-2501</link>
      <author>nucleics</author>
      <description><![CDATA[Yes you can do this. It is better to do nested PCR where you use internal primers for the second round PCR.

If you want to measure expression levels of your mRNA your really need to do real-time PCR - the results from just looking at the amount of PCR product produced in the end will really on be semi-qualitative at best.]]></description>
      <category>PCR Forum</category>
      <guid isPermaLink="true">http://www.nucleics.com/forum/read/12/2492/2501.html#msg-2501</guid>
      <pubDate>Thu, 07 May 2009 20:13:12 -0400</pubDate>
    </item>
  </channel>
</rss>
