- This topic has 0 replies, 1 voice, and was last updated 14 years, 9 months ago by .
Viewing 0 reply threads
Viewing 0 reply threads
- You must be logged in to reply to this topic.
Nucleics
By
I received a protocol of PCR for KO mice. In the protocol, they use sense primer (CGGTCAACAAACCTACTCAGAATCAGG) and antisense primer (CTGAACTCACATGGAGGCAGGATATAA) for WT identification,and use the same antisense primer (CTGAACTCACATGGAGGCAGGATATAA) with another antisense primer (GAGCGCGCGCGGCGGAGTTGTTGAC) for KO identification. The PCR progress is not going well. Does it make sense to use two antisense primers together?If yes, how it does?
Thank you.