Can two antisense primers work together

[Anonymous]

I received a protocol of PCR for KO mice. In the protocol, they use sense primer (CGGTCAACAAACCTACTCAGAATCAGG) and antisense primer (CTGAACTCACATGGAGGCAGGATATAA) for WT identification,and use the same antisense primer (CTGAACTCACATGGAGGCAGGATATAA) with another antisense primer (GAGCGCGCGCGGCGGAGTTGTTGAC) for KO identification. The PCR progress is not going well. Does it make sense to use two antisense primers together?If yes, how it does?
Thank you.

[Author]

Posts