- This topic has 5 replies, 5 voices, and was last updated 13 years ago by DanielT.
-
AuthorPosts
-
-
December 21, 2006 at 2:56 pm #1459DanielKeymaster
This is a hint that has resulted from how many time I seen people forget that the annealing Tm of a PCR is dependent on the Tm of the primer with the lowest Tm. As a good rule of thumb the best annealing temperature to use is 5˚C below the Tm of the primer with the lowest Tm. With well designed primer pairs the Tm will be very similar and so this is not critical, but sometimes this is not possible (for example when using long and short primers) – in these cases make sure you use the lowest Tm primer to work out what annealing temperature to use.
I have also seen a related problem when people are using tailed primers (ie primers with extra bases on the 5′ ends that are not homologous to the template). It is very common for people to forget that the annealing Tm is derived from the homologous region only. For example, if you have a 35 bp primer with a calculated Tm of 80˚C but only 18bp anneal to the template, then the Tm will be determined by the 18bp region. You may need to calculate this Tm separately and not just rely on what is printed on the side of the primer tube.
Daniel Tillett
Nucleics Support -
April 22, 2009 at 3:00 pm #1460monikaParticipant
please guide me to set annealing temp fpr my pcr with these two primers product size expected to be 1.7 kb
5’ cggaatcttggtccgcaataatgaaagtt 3’ for tm 59.4
5’cgggatccggttcggttgttcgcagttg 3’ rev tm 66.4 -
September 8, 2009 at 3:00 pm #1461DanielKeymaster
A good temperature to start at would be 55C and try going up from there.
Daniel Tillett
Nucleics Support -
September 14, 2009 at 3:02 pm #1462RajendraParticipant
FP- CATATG ATG AGTTCTGCG CTGCACCCCTCG
RP- GGATCCCCACGAGGTCGCTCCCGTCCGC -
December 9, 2010 at 3:03 pm #1463Hang tranParticipant
Please explain more clearly about Tm!
-
April 5, 2011 at 3:05 pm #1464DanielTParticipant
I have 32 isolates from soil . I have also extracted the DNA and doing the 16S rDNA pcr amplification. But for one group of isolates I am the primer I used has annealing temperature 58 as compare to another group of isolates which is 63 for the same primer.
-
-
AuthorPosts
- You must be logged in to reply to this topic.