- This topic has 2 replies, 2 voices, and was last updated 18 years, 8 months ago by .
Viewing 2 reply threads
Viewing 2 reply threads
- You must be logged in to reply to this topic.
Nucleics
By
Hi folks,
I am new to the area of PCR cloning and am trying to amplify a 3000bp region from a plasmid construct. I use Invitrogen VectorNTI’s (amplify selection) method to design a primer. What i get now is primers of 20bp length (both sense and antisense)with these calculated values
Contains region of the molecule from 13 to 3001
Tm: 80.7 C TaOpt: 55.3 C GC: 51.3
Sense Primer:
TAACTGGTTTCCTGAAAGGT
Similarity: 100.0%
Length: 20 Tm: 45.6 C GC: 40.0
dH: -150.2 kcal/mol dS: -394.6 cal/mol dG: -30.8 kcal/mol
Antisense Primer:
CCCATTCCAGCGCCAGGAGC
Similarity: 100.0%
Length: 20 Tm: 63.4 C GC: 70.0
dH: -169.9 kcal/mol dS: -427.7 cal/mol dG: -40.6 kcal/mol
Tm Difference: 17.8
GC Difference: 30.0
Is this alright to go with? or should i play around these values. Suggestions are very much appreciated. Thanks in advance
The primers really should be closer in Tm than what you have. I suggest that you try making your antisense primer shorter to bring down it’s Tm.
Daniel Tillett
Nucleics Support
Thanks a lot daniel! I would make it that way.